Evaluating the cytotoxic effect of crocin on MDA-MB-468 cell line based on apoptosis induction, ER stress, and autophagy markers
|
|
- Stewart Norris
- 5 years ago
- Views:
Transcription
1 Original Article Evaluating the cytotoxic effect of crocin on MDA-MB-468 cell line based on apoptosis induction, ER stress, and autophagy markers Hamid Heidarzadeh 1, S. Zahra Bathaie 2*, Saeid Abroun 3, Mohammad Ali Mohagheghi 4** 1- Ph.D. Candidate, Department of Clinical Biochemistry, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran 2- Professor, Department of Clinical Biochemistry, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran 3- Associate Professor, Department of Hematology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran 4- Professor, Cancer Institute, Imam Khomeini Hospital, Tehran University of Medical Sciences, Tehran, Iran *Corresponding Address: Postal Code: , Department of Clinical Biochemistry, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran **Corresponding Address: Postal Code: , Cancer Institute, Imam Khomeini Hospital, Tehran University of Medical Sciences, Tehran, Iran Received: 22/Aug/2017, Accepted: 16/Sep/2017 Abstract Objective: Crocin, an important saffron ingredient, showed anticancer activity in a variety of cancer types, particularly breast cancer. However, little information is available on the mechanism of its action. Previous studies indicate apoptosis induction by crocin in some cancer cells. This study aims to investigate the effect of crocin on the MDA-MB- 468 breast cancer cell line in order to investigate its effect on caspase 9 (Cas9) and cleaved-cas9, expression and splicing of XBP1, and accumulation of LC3-II. Methods: We used the MTT assay to investigate the cytotoxic effect of crocin on MDA- MB-468 breast cancer cells. Next, Cas9 and cleaved-cas9 levels were evaluated by Western blot analysis. Splicing of XBP1 mrna and expression of the spliced protein (XBP1s) was investigated by RT-PCR and Western blot, respectively. The accumulation of LC3-II was also evaluated by Western blot. The obtained results were analyzed and reported by Image J software. Results: The results showed a time and dose-dependent cytotoxic effect of crocin in MDA-MB-468 cells. The expression of Cas9 and its cleavage, therefore, the ratio of cleaved-cas9/cas9 significantly increased. Crocin treatment led to a noticeable increase in splicing of XBP1 mrna, expression of XBP1s, accumulation of LC3-II, and increased the LC3-II/LC3-I ratio in these cells. Conclusion: The data have shown induction of apoptosis in these breast cancer cell lines after crocin treatment. Because of the observed changes in UPR markers and autophagy, it seems that these pathways are possibly involved in this process and in intracellular regulations. Keywords: Breast cancer, Cleaved-Cas9, UPR, XBP1 splicing, LC3-II accumulation Pathobiology Research, Vol. 20 ( ), No.4, Pages: Pathobiology Research, Vol. 20 ( ), No. 4 73
2 ت ٥ ر مقاله اصیل بررسی اثر سمی کروسین بر رده سلولی MDA-MB-468 بر اساس القای آپوپتوز و تغییرات نشانگرهای تنش شبکه اندوپالسمی و اتوفاژی **4 3 *2 1 حمید حیدرزاده سیده زهرا بطحایی سعید آبرون محمد علی محققی 1- دانشجوی دکتزی تخصصی گزوه بیوشیمی ببلینی دانشکذه علوم پزشکی دانشگبه تزبیت مذرس تهزان ایزان 2- استبد گزوه بیوشیمی ببلینی دانشکذه علوم پزشکی دانشگبه تزبیت مذرس تهزان ایزان 3- دانشیبر گزوه همبتولوژی دانشکذه علوم پزشکی دانشگبه تزبیت مذرس تهزان ایزان 4- استبد مزکز تحقیقبت سزطبن بیمبرستبن امبم خمینی دانشگبه علوم پزشکی تهزان تهزان ایزان *آدرس نویسنذه مسئول: ایزان تهزان کذپستی: دانشگبه تزبیت مذرس دانشکذه علوم پزشکی گزوه بیوشیمی ببلینی bathai_z@modares.ac.ir **آدرس نویسنذه مسئول: ایزان تهزان کذپستی: دانشگبه علوم پزشکی تهزان مزکز تحقیقبت سزطبن بیمبرستبن امبم خمینی mamohagheghi@yahoo.com چكيذ دریبفت مقبله: 36/55/31 پذیزش مقبله: 36/56/25 ذف: وش ػ ٥ اص تشو ٥ جبت فلبس صففشا اػت و خ اف ضذ ػشعب ٣ آ س ٢ ا اف ٣ اص ػرشعب رب ثر ٤ رظ ػرشعب سؼرنب دس غب قبت اخ ٥ ش لج ٣ ب داد ؿذ اػت. ثب ا ٤ حب اعالفبت ثؼ ٥ بس و ٣ اص ىب ٥ ؼ اثش ا ٤ ر تشو جر د اػرت. غب قربت ا مب ٢ آس سن ص دس ػب ٤ ش ػ ب ٢ ػشعب ٣ تحت دس ب ثب صففرشا ٤ رب وش ػر ٥ سا رب داد اػرت. دس ا ٤ ر سرظ ؾ ثرب ذف ثشسػ ٣ س ٥ شا ٤ ؾ ث ٥ ب سش تئ ٥ اثش وش ػر ٥ ثرش سد ٠ ػر ٣ MDA-MB-468 ػرشعب سؼرنب دس ؾرش اػرت ترب ث ٥ رب ؿىؼرن وبػرزبص 9 XBP1 تج سش تئ ٥ LC3-II دس ت ٥ بس ؿذ ثب ا ٤ تشو ٥ ت ثشسػ ٣ ؿ د. م اد ي ريش ب: ػ جؾ MTT ثرشا ٢ ثشسػر ٣ اثرش ػر ٣ وش ػر ٥ ثرش سد ػر ٣ رب جشد اػرنفبد ؿرذ. ػرزغ س ٥ رشا ٤ ؾ ط XBP1 وبػزبص اص ش افضاس دس ػغح mrna ث ٥ ب سش تئ ٥ س ٥ شا ٤ ؾ ؿذ )XBP1s( ث تشت ٥ ت ثب RT-PCR ػرنش ثرالت ثشسػر ٣ ؿرذ. ث ٥ رب 9 وبػزبص ؿىؼن ؿذ تج ٥ ض LC3-II ثب س ؽ ػنش ثالت ثشسػ ٣ ؿذ ذ. ٥ رضا ث ٥ رب ا ٤ ر سبسا نش رب ثرب اػرنفبد Image J ث ك ست و ٣ ضاسؽ ؿذ. وتبیج: وش ػ ٥ ث ك ست اثؼن ث د ص ص ب جت شي سد ػ ٣ MDA-MB-468 ؿرذ. ت ٥ ربس ثرب وش ػر ٥ ت ٥٥ رش لبث ت ج ٣ دس فقب ؿرذ وبػرزبص 9 ؿىؼرن آ دس ن ٥ جر افرضا ٤ ؾ ؼرجت Cleaved-Cas9/Cas9 داؿرت. س ٥ رشا ٤ ؾ ط ٥ ض XBP1 سغ اص ت ٥ بس افضا ٤ ؾ ٤ بفت. چ ٥ افضا ٤ ؾ ق ر ٣ داس ث ٥ رب سرش تئ ٥ سش تئ ٥ وتيج گيری: LC3-II افضا ٤ ؾ ؼجت LC3-II/LC3-I دس ا ٤ ػ ب ب ذ ؿذ. ت ٥٥ شات رب ش ب ٢ س ٥ رشا ٤ ؾ ؿرذ )XBP1s( XBP1 تج ر نب ٤ ج ب داد و ا ٤ سد اص ػ ب ٢ ػشعب سؼنب سغ اص ت ٥ بس ثب وش ػر ٥ داربس آس سنر ص ؿرذ. ثرب ت جر ثر ت ؾ ٥ بت دس ػ ٣ مؾ داس ذ. ؼر ٥ ش ب ٢ UPR ات فربط ٢ احن رب ا ا ٤ ر د ؼر ٥ ش ٥ رض دس س ٥ رجشد ػر ثر ػر ت رشي ػر ٣ کليذياژگبن: ػشعب سؼنب وبػزبص 9 ؿىؼن ؿذ ت ؾ ؿجى ا ذ سالػ ٣ س ٥ شا ٤ ؾ XBP1 تج LC3-II پژي ش ایآسیبشىاسیزیستی دير 02 شمار 4 زمستان 9316 صفحات: پژي ش ای آسیبشىاسیزیستی دير 02 شمار 4 زمستان
3 مقذم بػرت ػرغح حفرؼ بجشت ثمب تىث ٥ ش ػ سؿذ ر ثر ضد ٤ ه ثؼ ٥ بس استجبط ثب فشآ ٤ ذ ب ٢ ػ دس ا شط ٢ ثر ػر دػنشػ ٣ ب ذ خبسج ٣ ب ٢ س ٥ ب اص ثؼ ٥ بس ٢ ؼن ذ. ثر ػر ٥ ا ن ربث ٣ ٥ رب ج ٣ رب ٢ ٤ رب سؿذ ف ا غزا ٣٤ اد ؼ ٥ ش ب ٢ عش ٤ ك اص ؿذ س ض ب ٣٤ ػ ٣ دس د ٤ ذ ثب ب ٢ چ ر ٥ ٣ د رذ. ٥٥ ش ت سا ػ ف ٥ ض ٤ ط ٢ ػ ٣ دسخ س آ بث ٥ ؼ ٣ - ؼ ٥ ش ب ٢ سؿذ ٢ حشن ب ٢ ث سبػخ دس ػ ب سا تجض ٤ ا ٢ -خ د او ؾ ب ٢ بس بوش ى ب ػبخت آس سنر ص لج ٥ ر اص ػ ٣ فشآ ٤ ذ ب ٢ اص ثؼ ٥ بس ٢ و ذ. ٣ فقب ؼ ٥ ش ث ػ ٥ ا ن بة ا شط ٢ ػبص ػ خت تشج ات فبط ٢ )Endoplasmic reticulum stress( ا ذ سالػر ٣ ؿجى ت ؾ فر ثر ػ ٣ فشآ ٤ ذ ب ٢ ا ٤ ػشعب دس =1>. ٣ ؿ د و نش ؾر س ث ٥ ٣ س د س ٥ ؾ ػشعب ٣ ػ ب ٢ ث ٣ س ٤ تىث ٥ ش اػرت سا ىبس ب ٣٤ اص اػنفبد ػشعب دس ب دس دس ب ٣ ا ذاف ٣ ػبصد. ن لف سا ث ٣ س ٤ سؿذ ا ٤ و Crocus ( صففرشا ٥ رب ؿرذ خه وال ب ٢ صففشا خ اف ث د داسا ث د ٥ آ دس ج د تشو ٥ جبت )sativus.l د ب ٢ دس سظ شا اص ثؼ ٥ بس ٢ ت ج سد فشا ا ص ٤ ؼن ٣ تشو ٥ جربت ر ثؼر ٥ بس خر اف اص ٤ ىر ٣ =2>. اػرت ث د اخ ٥ ش دس رب ٣ آثربس اػرت شفنر لرشاس غب قر سد و صففشا ػبثم تبس ٤ خ ٣ حبػ اص =3>. اػت ػشعب س ٢ س ٥ ٥ ش ٢ و ذ ثر ثرذخ ٣ ٥ دس رب ثشا ٢ تشو ٥ ت ث ك ست صففشا اص اػنفبد صففرشا ص ٤ ؼرن ٣ خ اف =4>. ثش ٣ شدد ٥ الد اص ثقذ د لش ث ٤ ظ آ ثب ٤ نبث ٥ ت ب ٢ ث ت سطکريسیهدررد سل لیMDA-MB-468 آپ پت ز تىششبک اوديپالسمیيات فاژی القای ؿب آ وبس ت ٥٤ ذ ب ٢ س ٥ ىش وش ػر ٥ )Crocetin( وش ػرن ٥ )Crocin( وش ػ ٥ )Picrocrocin( تشو ٥ جبت ا ٤ س ٢ غب ق ا ش ص داسد استجبط اص =2>. اػرت شفنر لشاس سظ شا اص ثؼ ٥ بس ٢ ت ج سد ج فر اص خ ر ع ٣ صففشا فلبس ف ٥ ن ؿ ٥ ٥ ب ٣٤ ؾش مغ ح رب ٢ دس و صففشا س اػت. عج ٥ ق ٣ ثب ٤ تشو ٥ جبت وش ػر ٥ تشو ٥ رت اص بؿ ٣ اػت ب ذ لبث سل ٥ ك ثؼ ٥ بس د اػت. آة دس ح بدس وبس ت ٥٤ ذ ب ٢ اص ٤ ى ٣ و اػت دس صففشا فلبس ػشعب ٣ ضذ افؼشد ٣ ضذ خبك ٥ ت دس چ ر ٥ خن ف و س ب ٢ فش ب اص ف ٣ ن =5>. اػت ؿذ ؿ بخن اخ ٥ ش د ١ ا ذ ف ٣ سظ ؾ ب ٢ سؼرنب ػشعب ص ب ٥ ب دس ػشعب ب ؿب ٤ تش ٤ اص ٤ ى ٣ ش ب ٢ ص ٤ ش ؿ بخت اػت ب ث ٥ بس ٢ ٤ ه و اػت سر ٥ ؾآ رب ٣ اػرت ؿرذ ث ٥ نش حب دس س ص ث س ص آ ف ا ر اص آ تریث ٥ شسرز ٤ ش ٢ ثر د ٥ ر ث ٥ بس ٢ ا ٤ ؿ بػ ٣ ػجت ا ٤ ر ث ٥ رنش س ٥ چ ٥ رذ ٣ جرت ظاد ػ ب ذ ص ٤ بد ٢ ثؼ ٥ بس ساػرنب ٢ دس فشا ا ر ٣ تالؽ ب ٢ د ٥ ث ٥ ٣ ؿ د. ث ٥ بس ٢ ث ٥ ساثغ ٤ بفن ثب ٣ ٥ ف ذ ب ش ب ٢ ؿ بخت سؿذ بس ا جرب حرب دس آ ب سد دس جذ ٤ ذ اعالفبت وف آ ب دس داس رب ٢ اص ث نرش اػرنفبد تحم ٥ مبت ا ٤ ذف اػت. س ؽ رب ٢ ٤ رب داس رب ت ٥ رذ ٤ ب ا ٤ جبد دس ب ثشا ٢ دػنشع ثرشا ٢ ؿرذ اسا ٤ ر جذ ٤ رذ رذ رب ٢ اػربع ثش جذ ٤ ذ دس ب ٣ سؼرنب ػشعب =6>. اػت آ دس دخ ٥ ىب ٥ ؼ ب ٢ ػشعب ػرشعب اص سغ اػت ا ٤ شا ٣ ص ب ث ٥ دس ثذخ ٣ ٥ ؿب ٤ تش ٤ ص رب ثر ٥ دس ثذخ ٣ ٥ اص بؿ ٣ ٥ ش شي فب د ٥ س ٤ ا ر اص ثقرذ ا ٤ رشا دس ػرشعب ا ٤ ر ؿ ٥ ؿ ػ اػت. ا ٤ شا ٣ رضاسؽ ج رب دس و اػت ا آ اص سب ٥٤ تش ػب 10 ػب 8>. =7 اػت ؿذ ث رر ك رخ ٥ ررش ػرربخت جب ٤ ررب ا ذ سالػرر ٣ ؿررجى سبت ط ٤ ى ٣ ف ٥ ض ٤ ط ٤ ه ؿشا ٤ ظ اػت. تشؿح ٣ ب ٢ سش تئ ٥ ثر جرش ٣ و رذ خن سا سش تئ ٥ ب كح ٥ ح خ سد ٣ تب و ؿذ ثبص سش تئ ٥ ب ٢ سبػخ ب ث ػ ٣ ؼ ٥ ش ب ٢ ؿذ فقب سبػرخ ا ٤ ٣ ؿ د. )Unfolded Protein Response: UPR( دس د ب ٣ ا ٤ داسد تیث ٥ ش ػ ٣ شي دس ثمب دس ب سبػخ ا ٤ ٥ ؼت. ؿذ ؿ بخن ث خ ث ٣ اثش ىب ٥ ؼ ؿرجى دس غرب ٣٤ دس سش تئ ٥ رب ٢ ث ػ ٥ ػ ٣ س ٥ چ ٥ ذ ػر ٣ دس س ٥ ب ب ٢ ا نمب ثب و ٣ ؿ د ؿش ؿ ا ذ سالػ ٣ دس ج د ف بكش ث اتلب س ٤ ؼ ٣ ف ا ا ٤ جبد ؼن ث دس ك ست د ث و ٣ ؿ د سش تئ ٥ ب ٣٤ ث ٥ ب ث جش DNA ٣ و رذ ذا ٤ ت شي ٤ ب ثمب ػ ت ث سا ػ خن ف ؿشا ٤ ظ 39 Pathobiology Research, Vol. 20 ( ), N
4 ي مکاران حمیدحیدرزاد Inositol-requiring ( IRE1 سرش تئ ٥ رب ا ٤ ر اص ٤ ىر ٣ =9>. ٢mRNA س ٤ ج و ئربص ٢ فقب ٥ رت ثرب ور اػت )enzyme 1 تجذ ٤ XBP1s ؿذ ٤ شا ٤ ؾ ؿ ث سا XBP1u ذ ٤ شا ٤ ؾ )X-box binding protein 1( XBP1s سرش تئ ٥ ر ٣ و رذ. دس و ٣ و ذ فقب سا ط ب ٣٤ ث ٥ ب س ٤ ؼ ٣ فب ٤ ه ث ف ا خ سد ٣ تب =10>. داسد مؾ ػ اص ٤ ى ٣ ات فبط ٢ ؼ ٥ ش ق ٥ ة سش تئ ٥ ب ٢ حزف فشآ ٤ ذ ؿرجى تر ؾ رب دس ور ػ ٣ ب ٢ ىب ٥ ؼ ور اػت )Autophagy( ات فبط ٢ ٣ ؿ د ت ؾ ٥ ا ذ سالػ ٣ ٥ ض فشآ ٤ ذ ا ٤ ت ج جب ت ع س ث ثشا ٢ ىب ٥ ؼ ٤ ه ت ا ذ ٣ سب ٤ رذاس ػربص ٢ فشآ ٤ ذ ٤ ه ات فبط ٢ ؿ د. ػ شي ٤ ب ثمب ثذ ػ ٣ آػ ٥ ت ؿشا ٤ ظ دس و اػت عج ٥ ق ٣ ؿشا ٤ ظ دس ت لف ٤ رب ػ ٥ ن سالػر اص ثخرؾ رب ٣٤ فشآ ٤ ذ ا ٤ دس ٣ ؿ د تذ ٤ ذ او ئ ٣ ثش شفن دس غب د سا ب ا ذا ه ات فرب ص ب ث رض ثب ب ٤ ت دس ٣ ؿ د تى ٥ )Autophagosome( ؿر د ٣ ض آ دس تشو ٥ جبت ٥ ض ص ثب ات فب ص ؿذ ا ٤ جربد ثرشا ٢ ات فربط ٢ فشآ ٤ رذ آغبص دس اك ٣ مؾ 12>. =11 ULK1 Beclin1 سرش تئ ٥ د ثر ػر ٥ جذاو رذ غرب ٢ ؿج فشآ ٤ ذ ٤ ه ث ػ ٥ ع ٤ ػبص ٢ شح دس ٣ ؿ د ا جب اتب فؼفبت ٥ ذ ٤ ث اتلب ثب LC3-I سش تئ ٥ ؿذ ث ث ٥ ى ئ ٥ ن ٥ ػبخنبس ٢ سش تئ ٥ ٤ ه ف ا ث LC3-II ث ؿذ تجذ ٤ آ ٥ لؼر ت دس غرب ورشد س ٥ ذا ا نذاد ثشا ٢ فؼف ٥ ز ٥ ذ ب ا نمب ٣ سش تئ ٥ ا ٤ تج ٥ شد ٣ لشاس ات فب ص ث ٥ ش ٣ دس ٣ =13>. اػت ات فبط ٢ جش ٤ ب ثشا ٢ ب ش ٢ ث ف ا ػ دس تشو ٥ جربت داس ب اص ثؼ ٥ بس ٢ و داد اػت ب غب قبت ؼ ٥ ش ب ٢ وشد فقب ط ب ث ٥ ب دس ٥٥ ش ت عش ٤ ك اص ػشعب ضذ آثبس ات فبط ٢ )Apoptosis( آس سن ص عش ٤ ك اص ػ ٣ شي ج ر اص ٥ رض آ ررثش ر اد صففشا داس ذ. ت س ٢ ضذ ث ٥ رب ثرش ضذػرشعب ٣ خر اف داؿرن ثب و ؼن ذ تشو ٥ جبت ٣ 18-14>. =2 ٣ زاس ذ اثش خن ف ط ب ٢ ٤ ىر ٣ ث ف ا وش ػ ٥ ث د دخ ٥ احن ب غب ق ا ٤ دس چ ٥ آس سن ص ا مب ٢ دس صففشا ػشعب ضذ نبث ٥ ت ب ٢ اص MDA-MB- ػر ٣ سد دس ات فربط ٢ UPR ؼ ٥ ش ب ٢ دس ؿرذ. ثشسػر ٣ داسد ا ٥ رت ثر د نبػرنبص ٢ ث د ٥ ر و 468 ؿرذ ؿىؼرن 9 وبػزبص ؼجت 9 وبػزبص ؿذ فقب ث بثشا ٤ رب ش ب ٢ ثر ف ر ا )Cleaved-Cas9/Cas9( 9 وبػزبص ث )ت ٥ ررذ س ٤ ؼرر ٣ ػررغح د دس XBP1 ط ث ٥ ررب آس سنرر ص ثرر ف رر ا )XBP1s سررش تئ ٥ )ت ٥ ررذ ط ث ٥ ررب )mrna LC3- ؼررجت افرضا ٤ ؾ LC3-II تج ر UPR رب ش ب ٢ ت ٥ ربس ػ ب ٢ دس ات فبط ٢ ؼ ٥ ش ب ش ف ا ث II/LC3-I ؿذ. ثشسػ ٣ وش ػ ٥ ثب ؿذ ريش ب ي م اد تخلاي ي زعفاران م ا ترکيباب استخراج کريسيه ثر صففرشا اجضا ٢ ػب ٤ ش اص وش ػ ٥ خب قػبص ٢ جذا =19>. ؿذ ا جب ث د ؿذ داد ؿشح سا ا ذاص ٢ لجالا و س ؿ ٣ ػن س ٢ ؿؼن اص سغ صففشا آث ٣ فلبس خنلش ع س ث ر س ٢ جرزة ؿرذ ثرشد فقب 9- آ ٥ ٥ وش بت شاف ٣ س ٢ ع ٥ فػ ج اص اػنفبد ثب ػن اص ؿذ خبس ت حل دس جزة داسا ٢ ثخؾ ؿذ. خ ا ذ ب نش 440 ع دس خرال تحت تجخ ٥ ش اص ثقذ ب( )وش ػ ٥ ب نش 440 ع وش ػر ٥ ؿرذ. تجرذ ٤ سر دس ثر ٥ ف ٥ ٥ ضو رذ دػن ب ت ػظ Infrared ( IR ع ٥ رفػر ج ٣ س ؽ رب ٢ ثرب ؿرذ اػرنخشا تی ٥٤ رذ ثشسػ ٣ ف لش ٢ تح ٥ تجض ٤ )Spectroscopy ؿذ ح ػش فبلذ وت ح ٥ ظ دس حبك س دس ب ٤ ت دس ؿذ. ؿذ. اػنفبد تحم ٥ ك ع ٣ سل ل کطت MDA-MB-468 رخب ٤ ش شوض ػر ٣ ثب ه اص MDA-MB-468 ػ ٣ سد ورت حر ٥ ظ دس ؿرذ خش ٤ رذاس ٢ ا ٤ رشا ط ن ٥ ىر ٣ ص ٤ ؼن ٣ Dulbecco's Modified Eagle Medium: ( DEMEM-F12 40 آسیبشىاسیزیستی دير 02 شمار 4 زمستان 9316 پژي ش ای 04
5 ت سطکريسیهدررد سل لیMDA-MB-468 آپ پت ز تىششبک اوديپالسمیيات فاژی القای ؿذ. حبػج 10 غ ؾرت ثرب آ ش ٤ ىرب( Gibco( )Nutrient Mixture 12-F 41 Pathobiology Research, Vol. 20 ( ), N ا ى ثبت س ث وت T25 ػ وت فالػه دس ػش دسكذ ؿذ. نم CO 2 دسكذ 5 غ ؾت شع ة ا ٢ ثب MTT سىجص کريسيه تعيايه ي سميت بررسی IC50 اص IC50 تق ٥ ر ٥ وش ػر ٥ ػ ٥ ت ٥ ضا ثشسػ ٣ ؾ س ث 3-(4,5-Dimethylthiazol-2-yl)-2,5-= MTT آص ررررررررر اػرنفبد ص ٤ رش ثر كر ست <diphenyltetrazolium bromide خب ر 96 س ٥ رت دس MDA-MB-468 رب ٢ ػر اثنرذا ؿذ. ٥ رشد لشاس ػ اب ه ش دس و ث ك ست ٣ سؿرذ اؼرج ٥ ذ اص ثقرذ ؿرذ ذ. داد ورت وب ح ٥ ظ دس 48 ترب )24 دسكرذ حرذ د ػر ٣ ترشاو ب ػ دس ػربفت ثر رذت ػر رب ػربفت( دس رش ٥ ر ٣ 5-1 ث ٥ ب ٢ غ ؾت ثب وش ػ ٥ تشو ٥ ت قشم رذ ت ٥ ربس ب ٢ ػ آص ب ٤ ؾ ا ٤ دس ؿذ ذ. ت ٥ بس ٥ نش ٣ ٥ ت ٥ ربس ص رب زؿرت اص سرغ ؿرذ ذ. اػرنفبد و نش ث ف ا )5 حرربMTT٢ وررت حرر ٥ ظ ٥ ىش ٥ نررش 100 حررذ د ثر رذت جذدا ؿذ اضبف اب ه ش ث ٣ ٥ ش / ٥ ٣ ٥ نش( ؿرذ ذ. داد ا نمب ػب ن ٣ شاد دسج 37 ا ى ثبت س ث ػبفت 4 تخ ٥ ب ػ س ٢ وت ح ٥ ظ ػبفت 4 زؿت اص سغ ررش ثرر )Dimethyl sulfoxide( DMSO ٥ ىش ٥ نررش 100 شصا رذ دس دل ٥ مر 10 ثر رذت س ٥ رت ؿرذ. اضربف اب ره ا ٤ جربد )Formazan( ف س ربصا ترب ؿرذ داد لرشاس )Shaker( خر ا ؾ دػرن ب و ه ث ػزغ ؿ د. ح وب ع س ث ؿذ جزة ٤ ضا ا ؿرذ. ثجت ب نش 570 دس اب ه ش ب ٢ ح رذ ت ٥ ربس و نرش رب ٢ ػر ٢ ثمب ٥ ضا آص ب ٤ ؾ ا ٤ دس دس ب ػ ثمب ٢ ٥ ضا ادا دس ؿذ. شفن ؾش دس 100 دسكذ آ دس ص رذ ػر رب ٢ دسكرذ ث كر ست ت ٥ بس حب ت ش ت ٥ بس حب ت دسكرذ( 100 ثمرب ٢ )ثب ذ ت ٥ بس ب ٢ ػ ث ثرش وش ػر ٥ ػ ٥ ت ٥ ضا تق ٥٥ ثشا ٢ IC50 د ص ؿذ. حبػج آص ب ٤ ؾ ا ٤ دس د ص ث اثؼن ص ب ث اثؼن داس اػبع سل لی رد تيمبر MDA-MB-468 م لك لی بررسی بی ب مىظ ر کريسيه ترکيا بب XBP1s سش تئ ٥ رب ٢ ث ٥ ب ثش وش ػ ٥ اثش ثشسػ ٣ ث ؾ س LC3- سرش تئ ٥ تج 9 وبػزبص سش تئ ٣ ٥ RNA ػغح دس ػرب ن ٣ نرش ٢ 6 س ٥ ت ب ٢ دس MDA-MB-468 ػ ب ٢ II ثرب ؿذ ذ. داد وت DMEM-F12 وب وت ح ٥ ظ حب ٢ دس وش ػ ٥ د ح ثب ػ ب دسكذ ٢ 70 تشاو ب ذ ت ٥ ربس )IC50( ٥ ٣ ٥ نرش دس ٣ ٥ ش 3 غ ؾت ثب وت ح ٥ ظ ثب ػ ب ت ٥ بس اص سغ ػبفت ص ب ب ٢ دس ؿذ. ثررب ؿؼرن خ رره )Phosphate buffered saline( PBS س ٤ زررب ثرربفش ٥ ىش ٥ نررش 200 تررب 150 اػررىب زش اص اػررنفبد ج رآ س ٢ )Radioimmunoprecipitation assay buffer( ػب ن ٣ شاد دسج 4 د ب ٢ دس ػب نش ٤ ف ط اص ثقذ ؿذ فلبس ث ف ا س ٣٤ ح دل ٥ م 10 ث ذت دل ٥ م دس د س ؿذ. اػنفبد ثالت ػنش تح ٥ ا جب ثشا ٢ ػ ٣ وساخ بارداری پليماراز- زوجيار ای ياکاىص معك س )RT-PCR( ػ ب ٢ ج آ س ٢ اص ثقذ RNA اص cdna ا ٤ جبد ثشا ٢ ( EDTA تش ٤ زؼررر ٥ - ت ػرررظ ؿرررذ ت ٥ ررربس Trypsin- ثرب ػ ب ؿؼن ٢ )Ethylenediaminetetraacetic acid شاحر ث تشت ٥ رت RNA اػنخشا ػ سػ ة ت ٥ PBS و ٥ رت دس ؿذ ٤ بد اثنرذا GeneAll Biotechonolgy Co. Ltd. ح رب اص اػنفبد ثب ٥ ض )Trizol( تشا ٤ ض ٥ ٣ ٥ نش 1 ثب حرب ٢ آة ٥ ىش ٥ نش 50 دس RNA ب و ٥ ت دس ج د ػن ثرشا ٢ ؿذ ج آ س ٢ )Diethyl pyrocarbonate( DEPC فش ٤ ضس ث ػشفت ث ثقذ ٢ آص ب ٤ ؾ ب ٢ RNA و ٥ ف ٥ ت ثشسػ ٣ RNA و ٥ ف ٥ رت چ ر ٥ ؿرذ. نمر ػب ن ٣ رشاد دسج 80- اػرنخشا ثرشا ٢ دسكرذ 0/8 آ ربسص ط اص اػرنفبد ثرب ؿرذ
6 HyperscriptTM RT Mastermix و ٥ رت اص اػنفبد ثب ؿذ ا جرب RT-PCR اور ؾ ج ث ٣ وش GeneAll ؿشوت Kit ؿذ. ػبخن ؾش سد cdna PCR ياکىص ي مکاران حمیدحیدرزاد 28sRNA 18sRNA آؿىبسػربص ٢ ادا ر دس ؿرذ. ثشسػر ٣ ع دس RNA س ٢ جزة ؼجت ب دساح دػن ب ث ػ ٥ 230 ثر رب نش 260 ب نش 280 ث ب نش 260 ب ٢ ر س ٢ جرزة رؼجت و ر رب ٣٤ اص ؿذ. ػ جؾ ب نش ر س ٢ جرزة ؼجت 2/2 ترب 1/8 ٥ رب رب نش 260/280 ؿرذ ػربخن ثررشا ٢ داؿررن ذ 1/9 تررب 1/7 ٥ ررب 260/230 ر RT-PCR اور ؾ ا جرب ثرشا ٢ ؿذ. اػنفبد cdna ثرشا ٢ PCR اور ؾ ؿذ اػنفبد )Primers( آغبص ش ب ٢ ا ث ف ا cdna اص اػنفبد ثب XBP1 ط ب ٢ ث ٥ ب ثشسػ ٣ 1(. )جذ شفت ا جب ص ٤ ش آغبص ش ب ٢ شفن ؾش دس ا ث ف ا لج شح دس آ ذ ث دػت RNA آ ب خلبت اػنفبد سد آغبص ش ب ٢ ٥ ؼت 1 جذيل ژن آغبزگر ت الی ببز( )جفت محص ل اوذاز سبوتیگراد( )درج دمب -سيت زیه گ اويه درصذ 45/45 54/55 58/4 61/ :UXBP1 257 :sxbp1 TTACGAGAGAAAACTCATGGCC ج ٣٤ : GGGTCCAAGTTGTCCAGAATGC ثش ن ٣ : XBP1 بال يسترن اونرβ-( ٥ ثنرب ث ٥ رب اص آص رب ٤ ؾ ا ٤ دس ؿذ. ؽب ش ساد ٤ شاف ٣ ػرنش داخ ر ٣ و نش ف ا ث )ab :4000( )actin ؿذ. اػنفبد ثالت آمبری تحليل ؿذ. ا جب د تب ٣٤ ث ك ست ش ث شث ط آص ب ٢ تح ٥ ر اػت ؿذ داد ب ٤ ؾ mean±sd ث ك ست ب داد One Way آص SPSS 19.0 ش افضاس اص اػنفبد ثب داد ب ػررغح ؿررذ. ا جرب )Post Hoc-Tukey HSD( ANOVA ؿرذ. شفنر ؾش دس )0/05>P( 0/05 اص و نش ب داد داس ق ٣ ثرب ثر د ق ر ٣ داس آ ربس ٢ ؾرش اص آ ب اخنالف و داد ب ٣٤ اػت. ؿذ خق ***( ** )* ػنبس فال ت وتبیج تخلي کريسيه اص صففرشا اجرضا ٢ ػرب ٤ ش اص وش ػر ٥ جذاػربص ٢ ثرشا ٢ =19>. ؿرذ اػرنفبد ثر د ؿرذ ا رذاص ٢ سا لجالا و ب ٣٤ س ؽ SDS- ط اص اب ره رش دس غب قر اص ثخرؾ ا ٤ ر دس Sodium dodecyl sulfate- Polyacrylamide ( PAGE 20 حب ٢ ػ ٣ فلبس دسكذ( )12 )gel electrophoresis )Bradford( ثشادفرر سد س ؽ ثرر ورر سررش تئ ٥ ٥ ىش ررش ا ىنش ف سص ا جب اص سغ ؿذ ثبس زاس ٢ ث د ؿذ ا ذاص ٥ ش ٢ اص سرش تئ ٥ ا نمب ف ػبفت( ٥ ٤ ه تب ٤ ه ت )110 ثرشا ٢ )Polyvinylidene fluoride( PVDF غب س ٢ ث ط ر ٥ ٤ ره تب ٤ ه ث ذت ٣ ٥ آ زش )400 ثالت ػنش ا جب غرب سش تئ ٥ ا نمب اص اع ٥ ب اص سغ شفت. ا جب ػبفت( 5 اشثر ٣ ثرذ خره )ؿر ٥ ش و رذ ؼرذ د ثربفش دس PVDF sc-( XBP1 ا ٥ آ ن ٣ ثبد ٢ ح دس آ اص سغ دسكذ( Cas9 )ab :2000( LC3-II )7160-1:1000 لررررشاس )9502S-1:1000( Cleaved-Cas9 )C3465-1:500( ث نل ثب ٤ آ ن ٣ ثبد ٢ ث اتلب ؿؼن اص سغ ؿذ. داد ررب ٣٤ ؿؼنر ٢ )1:10000 ا ٤ ررشا Razi Biotech( HRP و ٥ رت اص اػرنفبد ثرب PVDF غرب ب ٤ رت دس شفرت. ا جرب X-Ray فررررر ٥ Amersham ECL AdvancedTM 42 آسیبشىاسیزیستی دير 02 شمار 4 زمستان 9316 پژي ش ای 04
7 ت سطکريسیهدررد سل لیMDA-MB-468 آپ پت ز تىششبک اوديپالسمیيات فاژی القای ر سد ػربخنبس چ ٥ وش ػ ٥ ٢ ثب خ ف ب د ذ س ؽ ب ٢ اص وش ػ ٥ ػبخنبس تق ٥٥ خ ف ثشسػ ٣ ث ؾ س 1(. )ؿى ث د اػنفبد سد س ؽ دس ا نؾبس نب ٤ ج ؿذ. اػنفبد ف لش ٢ تح ٥ تجض ٤ IR ػ ج ٣ ع ٥ ف ج O 36/8 - N - - H 6/7 7/01 C 56/49 56/74 ف لش )دسكذ( ثؼن فش ج ب ٢ ثش ف بكش ٥ ضا )دسكذ( ف بكش تجشث ٣ ٥ ضا صففشا ؿ بػب ٣٤ ثشا ٢ تی ٥٤ ذ ٢ آص ب ٤ ؾ ب ٢ 1 ضكل اػنخشا وش ػ ٥ جزث ٣ ع ٥ ف ) )ا ف ؿذ وش ػر ٥ دس فرب ٣ ش ب ٢ تق ٥٥ ثشا ٢ IR ع ٥ فػ ج ٣ نب ٤ ج )ة( ( ف لش ٢ تح ٥ تجض ٤ نب ٤ ج ) 43 Pathobiology Research, Vol. 20 ( ), N
8 ي مکاران حمیدحیدرزاد بار کريسيه مختلف غلظت بی سل لی سميت سل ل بی MDA-MB-468 رشي جرت و وش ػ ٥ اص رثش ٢ غ ؾت ثشسػ ٣ ثشا ٢ MTT آص ر اص ٣ ؿ د )IC50( ب ػ اص ٣ ٥ دس ػ ٣ ػرشعب رب ٢ ػر آص رب ٤ ؾ ا ٤ دس 2(. )ؿى ؿذ اػنفبد نفرب ت د ص رب ٢ دس وش ػر ٥ ثرب MDA-MB-468 سؼرنب دس چ ر ٥ ٥ ر ٥ ٣ نرش دس ٥ ر ٣ رش 5-1 ثر ٥ وش ػر ٥ ا ٤ ر ث ؿذ. ت ٥ بس ػبفت نفب ت ب ٢ ص ب ثر اثؼرن ث ك ست ب ػ ت ٥ بس ثب MTT آص ب ٤ ؾ تشت ٥ ت ا جررب MDA-MB-468 ػرر س ٢ وش ػرر ٥ دص ص ررب ؾرش دس و نرش ش ث ف ا ذ ت ٥ بس ػ ب ٢ شفت ؿذ. شفن ضكل ا ٤ ر اص ٤ ره ش رثش د ص تق ٥٥ ثشا ٢ 72( )12 نفب ت ص ب ب ٢ وش ػ ٥ خن ف غ ؾت ب ٢ دس MDA-MB-468 ػ ث د ص ذ ٥ ضا داس 2 ث د. ٥ ٣ ٥ نش دس ٣ ٥ ش 3 ثشاثش ػبفت 48 ص ب دس وش ػ ٥ IC50 غ ؾت اػت. ؿذ داد ب تشو ٥ جبت ضكل اػنخشا RNA ب ٢ آ بسص ط 3 وش ػ ٥ ثب ؿذ ت ٥ بس MDA-MB-468 ػ ب ٢ اص ؿذ 44 آسیبشىاسیزیستی دير 02 شمار 4 زمستان 9316 پژي ش ای 00
9 ژن بيبن XBP1 در RNA سطح MDA-MB-468 ت سطکريسیهدررد سل لیMDA-MB-468 آپ پت ز تىششبک اوديپالسمیيات فاژی القای سل ل ابی در کريسيه بب ضذ تيمبر ط ٤ رشاؽ ثرش وش ػر ٥ ف ىرشد تق ٥ ر ٥ ثرشا ٢ ادا دس ث ف ا XBP1s ػ ب ٢ دس ا ذ سالػ ٣ ؿجى ت ؾ ب ش 3 ثرب ت ٥ ربس اص ثقرذ ػ ب MDA-MB-468 سؼنب ػشعب ص ب ب ٢ ف اك دس وش ػ ٥ ٥ ٣ ٥ نش ثش ٣ ٥ ش ثشسػر ٣ ؿرذ. اػنخشا آ ب RNA ؿذ ج آ س ٢ ػبفت ثب رذ ب ٢ جر د ؿرذ. ا جرب حبكر RNA و ٥ فر ٣ و ر ٣ RNA ث د ػب ب د ذ 28s 18s س ٤ ج ص ٣ RNA ب ٢ ذ ( )تجض ٤ خ سد دػت ؿ ٥ ٥ ب ٣٤ ؾش اص ب اػت. و ٥ ف ٥ ت ص ٤ ؼن ٣ ؾش اص 3(. )ؿى ث د ذ داسا سا ص اػنخشا RNA ب ٢ غ ؾت تق ٥٥ ث ؾ س چ ٥ ؿذ ت ب ٣ جزة ب سش تئ ٣ ٥ آ د ٣ فذ اص اع ٥ ب حل ع دس ب اػنخشا RNA ب ٢ غ ؾت صففشا ؿرذ. خ ا رذ ب نش ب ٢ تشو ٥ جربت ت ٥ بس اص ثقذ لج ؿذ ب ت ب ٣ ثشا ٢ 260/280 ؼجت ؿذ. ٥ ش ٢ ا ذاص آ ر د ٣ جر د فرذ ب د رذ و ث د 2 تب 1/8 ث ٥ تمش ٤ جبا اػت. سش تئ ٣ ٥ RNA داد لرشاس ثرب RT-PCR س ؽ ثر ػر ٥ ادا ر دس ط ٤ رشاؽ cdna ػربخت ا ر ث ف ر ا ؿذ اػنخشا XBP1 ث ف ا كفش( )ص ب ذ ت ٥ بس ػ ب ٢ ؿذ. ثشسػ ٣ ؿذ ذ. شفن ؾش دس و نش ػر دس وش ػر ٥ و داد ب 4( )ؿى حبك نب ٤ ج XBP1 ٤ شا ٤ ؾ ص ب ب ٢ دس MDA-MB-468 فش ت ٥ ذ افضا ٤ ؾ س ذ وشد ا مب سا RNA ػغح دس XBP1s ؿذ. ب ذ ص ب ع دس ؿذ ٤ شا ٤ ؾ فش پاريتئيه ابی بيبن بررسی XBP1s پريتئيه تجمع ي ضذ ضكست کبسپبز سل ل بی در کريسيه 9 وبػرزبص LC3-II MDA-MB-468 باب ضاذ تيمبر 9 وبػرزبص سش تئ ٥ ؿذ ؿىؼن ثش وش ػ ٥ اثش تق ٥٥ ثشا ٢ XBP1s سرش تئ ٥ ث ٥ رب آس سنر ص داخ ٣ ؼ ٥ ش ب ش ث ف ا سرش تئ ٥ تج ر ا رذ سالػر ٣ ؿرجى ت ؾ ب ش ث ف ا سؼنب ػشعب ب ٢ ػ دس ات فبط ٢ ب ش ف ا ث LC3-II دس وش ػرر ٥ ثرب ػرر رب ت ٥ ربس اص ثقرذ MDA-MB-468 ؿرذ. ثشسػر ٣ ثرالت ػرنش ثب ػبفت ب ٢ ص ب شفن ؾش دس و نش ث ف ا كفش( )ص ب ذ ت ٥ بس ػ ب ٢ ؿذ. ور ٣ د رذ ب ا ف( 5 )ؿى تحم ٥ ك اص حبك نب ٤ ج سش تئ ٥ ث ٥ ب ق ٣ داس ٢ ث ع س ص ب ب ٢ دس وش ػ ٥ چ ر ٥ داد. افرضا ٤ ؾ سا MDA-MB-468 ػ دس XBP1s ت ٥ ربس ص ب ب ٢ دس 9 وبػزبص سش تئ ٥ ثشسػ ٣ اص حبك نب ٤ ج ؿىؼرن 9 9 /وبػزبص وبػزبص ؼجت ق ٣ داس افضا ٤ ؾ ب د ذ ص ب ب ٢ دس )Cleaved Caspase9/Caspase9( ؿذ ة(. 5 )ؿى ث د ػبفت 6 كفش ص ب ب ٢ ث ؼجت ػبفت ٤ ه اص LC3-II سش تئ ٥ تج ثشسػ ٣ اص حبك نب ٤ ج ب ٤ ت دس افرضا ٤ ؾ ب ش د ٤ ش عشف اص LC3-II/LC3-I ؼجت عشف كفش ص ب ث ؼجت ص ب ب ٢ دس ؼجت ا ٤ ق ٣ داس ف ر ا ث كفش( )ص ب ذ ت ٥ بس ػ آص ب ٤ ؾ ا ٤ دس ث د. دس و نش و نش ث ف ا ثنب-اون ٥ سش تئ ٥ ث ٥ ب اص ؿذ. شفن ؾش 5 )ؿى ؿذ اػنفبد ثالت ػنش دس داخ ٣.) 45 Pathobiology Research, Vol. 20 ( ), N
10 ي مکاران حمیدحیدرزاد ضكل خن ف ص ب ب ٢ دس MDA-MB-468 ػ دس وش ػ ٥ ت ػظ XBP1 ط mrna س ٥ شا ٤ ؾ ا مب ٢ 4 ث )XBP1u( ذ س ٥ شا ٤ ؾ XBP1 ط )S/U( ذ ؿرذ تجرذ ٤ س ٥ شا ٤ ؾ ثش وش ػ ٥ اثش آ بسص ط ) )ا ف س ٥ شا ٤ ؾ ث ؿذ س ٥ شا ٤ ؾ ؼجتmRNA داس )ة( ص ب ث اثؼن ث ك ست mrna ػغح دس )XBP1s( ؿذ س ٥ شا ٤ ؾ XBP1 )0/565;P( 12 ثب 6 ص ب ث ٥ ٥٥ شات ت **: )0/000;P( ب ص ب ثم ٥ ثب كفش ص ب ث ٥ ٥٥ شات ت *: Image J ش افضاس ث ػ ٥ آ ذ ث دػت XBP1 )P;0/888( 24 ثب 12 ص ب ث ٥ ٥٥ شات ت :*** )P;0/245( 24 ثب 6 46 آسیبشىاسیزیستی دير 02 شمار 4 زمستان 9316 پژي ش ای 04
11 ت سطکريسیهدررد سل لیMDA-MB-468 آپ پت ز تىششبک اوديپالسمیيات فاژی القای 5 ضكل Cas9 XBP1s سرش تئ ٥ رب ٢ ث ٥ رب )ا رف( وش ػر ٥ ثرب ؿرذ ت ٥ بس MDA-MB-468 ػ دس آس سن ص ات فبط ٢ UPR دس ب ش سش تئ ٥ ب ٢ ثشسػ ٣ **: )0/000;P( ب ص ب ثم ٥ ثب كفش ص ب ث ٥ ٥٥ شات ت =*: داخ ٣ ( )و نش ثنب-اون ٥ ث ؼجت XBP1s سش تئ ٥ و ٣ ث ٥ ب )ة( LC3-I LC3-II Cleaved-Cas9 ص ب ث ٥ ٥٥ شات ت ػبفت ثرشا ٢ 9 وبػرزبص ثر ؿىؼن 9 وبػزبص و ٣ ؼجت ) ( <)P;0/002( 24 ثب 12 ص ب ث ٥ ٥٥ شات ت :*** )P;0/001( 24 ثب 6 )P;0/982( 12 ثب 6 12 ثرب 6 ث ٥ و ع س ٢ ث ػبفت ثب ػبفت 6 ص ب ث ٥ ق ٣ داس ٥٥ شات ت **: )0/0000;P( ب ص ب ت ب ث ٥ ٥٥ شات ت =*: آس سن ص وبػزبص ؿذ فقب ثشسػ ٣ **: )0/000;P( ص ب ب ثم ٥ ثب كفش ص ب ث ٥ ٥٥ شات =*:ت ات فبط ٢ ؿذ فقب LC3-II/I و ٣ ؼجت )د( ث د.> P 0/05; ػبفت 24 6 ث ٥ P ; 0/001 6 ص ب ث ٥ ٥٥ شات ت ة داس رب ٢ دس ؿرذ اسا ٤ نب ٤ ج و اػت روش ث ص ) P;0/000 (> 24 ثب 12 ص ب ث ٥ ٥٥ شات ت ***: )0/05;P( 24 ثب 6 )0/001;P( 12 ثب آص ب ٤ ؾ بػت. تىشاس ثبس ػ حذال ٥ ب ٥ تب 47 Pathobiology Research, Vol. 20 ( ), N
12 ي مکاران حمیدحیدرزاد بحث ػ سد ثش وش ػ ٥ ػ ٣ ػ ٥ ت اثش سظ ؾ ا ٤ ع ٣ بجشت نبػنبص غب ق ثشا ٢ و MDA-MB-468 ػشعب ٣ وبػزبص ؿذ فقب MTT ػ جؾ ؿذ. داد ب ؼن ذ ف ٥ ذ ؿرذ ؿىؼرن 9 9 /وبػرزبص وبػرزبص ؼجت افضا ٤ ؾ چ ٥ 9 آ ب ش نب ٤ ج ث د. ػ ب ا ٤ دس آس سن ص ا مب ٢ ب د ذ لبث ث ع س ص ب د ص ث اثؼن ث ك ست وش ػ ٥ و اػت دس داد. ورب ؾ سا MDA-MB-468 ػ رب ٢ ثمب ٢ ت ج ٣ UPR ؼر ٥ ش د ب ش ب ٢ ٥٥ شات ت ثبس ا ٥ ثشا ٢ حب ف ٥ ر ٣ د رذ ب و ٣ ؿ د ضاسؽ ػ ب ا ٤ دس ات فبط ٢ فشآ ٤ ذ دس ؼ ٥ ش د ا ٤ ا احن ب ؼن ذ. دخ ٥ سؼنب ػشعب ػ ب ٢ اص سد ا ٤ دس آس سن ص صففرشا دس رب ٣ ٤ ظ ٣ ب ٢ اص ثؼ ٥ بس ٢ اخ ٥ ش د د دس لرشاس حممرب ت ج سد ثؼ ٥ بس آ ػشعب ٣ ضذ آثبس ٤ ظ ث بس ٢ اثش ثشا ٢ نقذد ٢ ىب ٥ ؼ ب ٢ 18-14>. =2 اػت شفن آ اص ثخر ٣ و اػت ؿذ س ٥ بد ت س ب سؿذ ثش وش ػ ٥ سؿرذ ربس 23-20> =3 ػ ٣ شي آس سن ص ا مب ٢ ؿب ربس 20> =15 ػر ٣ اشخ دس و ٥ ذ ٢ مبط بس ثب ػ نب سش تئ ٥ ربص رب دػرن ٣ سب ٥٤ ت ؾ ٥ =18> ت شاص ب فقب ٥ ت تیث ٥ ش تحت سا نبػنبص فشآ ٤ ذ و اػت )Metalloproteinases( ؿذ داد ب تحم ٥ ك ا ٤ ع ٣ و ب ع س =17>. ٣ د ذ لشاس تر ج ٣ لبث ث ع س MDA-MB-468 ػ ٣ سد ثمب ٢ ٥ ضا دس ٤ بفت. وب ؾ ٥ ٣ ٥ نش دس ٣ ٥ 3 ش اص تش ثب غ ؾت ب ٢ دس تقذاد دس ا ذو ٣ افضا ٤ ؾ ب ش MTT ػ جؾ نب ٤ ج حب ف ٥ )1/5-1 وش ػر ٥ سرب ٥٤ ترش غ ؾرت رب ٢ دس ص ذ ػ ب ٢ سد دس ؿذ اسا ٤ لج ٣ نب ٤ ج ثب و اػت ٥ ٣ ٥ نش( دس ٣ ٥ ش ىب ٥ ؼر ٥ ض لج ٣ غب قبت =18>. داسد تبث HepG2 ػ ٣ ػرب ٤ ش دس ؿذ ثش ب س ٤ ض ٢ شي ا مب ٢ سا وش ػ ٥ ثشا ٢ اك ٣ دس ٥ ر ٣ رش 3 اص تش ثرب غ ؾت رب ٢ دس ػشعب ٣ ػ ب ٢ غب قربت ت رب ٣ حب ف ٥ دس =14>. اػت داد ب ٥ ٣ ٥ نش ػر ٣ سد ب ٢ اص ا اف ٣ دس سا وش ػ ٥ ػ ٣ غ ٥ ش اثش زؿن =15> ػرب آص ب ٤ ر ب ٣ ح ٥ ا ربت 21> =20 غ ٥ شػرشعب ٣ اػت. داد ب دس آس سنر ص ا مرب ٢ دس وبػرزبص ب مرؾ س ٥ ر ٥ غب قبت داد اػرت ب سا وش ػ ٥ ثب ت ٥ بس تحت ػشعب ٣ ب ٢ ػ لج ر ٣ نب ٤ ج تی ٥٤ ذ دس ٥ ض ثشسػ ٣ ا ٤ اص حبك نب ٤ ج 24>. =21 ػر رب ٢ دس ور داد رب ػرشعب ٣ ب ٢ ػ ػب ٤ ش دس سرش تئ ٥ ؿرذ فقب وش ػ ٥ ثب ت ٥ بس تحت MDA-MB-468 ؿرذ ؿىؼرن 9 9 /وبػرزبص وبػرزبص ؼجت افضا ٤ ؾ 9 وبػزبص ا ٤ ر ثر افنبد. اتفبق ت ٥ بس اص ثقذ ػبفت دس ث تشت ٥ ت شوض ٢ فب ث ف ا 9 وبػزبص سش تئ ٥ ؿذ فقب ثب تشت ٥ ت وش ػر ٥ ت ػظ آس سن ص ا مب ٢ داخ ٣ آس سن ص ؼ ٥ ش دس اك ٣ ؿذ. تی ٥٤ ذ ػ ٣ شي فب ث ف ا ػ ب ا ٤ دس ٤ رشا ٤ ؾ فشآ ٤ رذ لر ؿ ت ؾ تحت ػ ب ٢ دس ف با LC3II سرش تئ ٥ تج ر UPR ؼ ٥ ش ب ش ث ف ا XBP1 ؿرذ رضاسؽ ػ ٥ ق ٣ ث ع س ات فبط ٢ فشآ ٤ ذ ب ش ف ا ث ثرش وش ػر ٥ اثش ثشسػ ٣ ا ٤ ع ٣ د ٥ ث ٥ =25-27>. اػت اص سرش تئ ٥ mrna ػغح د ش دس XBP1 ٤ شا ٤ ؾ فشآ ٤ ذ LC3-II/LC3-I ؼرجت LC3-II سش تئ ٥ تج عشف ٤ ه ثرشا ٢ ؿرذ. ثشسػر ٣ ت ٥ بس تحت ػ ب ٢ دس د ٤ ش عشف اص ور ر ٣ سػرذ ث ؾش تحم ٥ ك ا ٤ ٤ بفن ب ٢ اػبع ثش ثبس ا ٥ ثر نق رك mrna ٤ رشا ٤ ؾ ت ؾ ٥ دس رثش ٢ ث ع س وش ػ ٥ ور تشت ٥ ت ا ٤ ث داسد. مؾ ص ب ث اثؼن ؿشا ٤ ظ دس XBP1 ػرغح دس رذ ٤ رشا ٤ ؾ فش ث ؿذ ٤ شا ٤ ؾ فش ب ٢ ؼجت اص ثقرذ ػربفت ػبفت ب ٢ دس تذس ٤ ج ث mrna ثرب ثرالت ػرنش نب ٤ ج داؿت. الحؾ ا ٢ لبث افضا ٤ ؾ ت ٥ بس ؿرذ ٤ رشا ٤ ؾ فرش افرضا ٤ ؾ رب ش لجر شح نب ٤ ج تی ٥٤ ذ ث د. ت ٥ بس ص ب ب ٢ دس XBP1s سش تئ ٥ ؼرجت ور داد رب آ رذ ث دػت نب ٤ ج د ٤ ش عشف اص ٤ بفرت افرضا ٤ ؾ ت ٥ بس اص ثقذ ػبفت 6 ص ب دس LC3-II/LC3-I ٤ بفرت. ادا ر چ ب ت ٥ بس اص ثقذ ػبفت 24 تب افضا ٤ ؾ ا ٤ داد ب سا ات فبط ٢ فشآ ٤ ذ ا مب ٢ دس وش ػ ٥ مؾ ٤ بفن ب ا ٤ سا ثضسي س د ػشعب ٣ ػ ب ٢ دس س ٥ ٥ غب قبت نب ٤ ج =24>. وشد تی ٥٤ ذ 48 آسیبشىاسیزیستی دير 02 شمار 4 زمستان 9316 پژي ش ای 03
13 ثر ؾرش تحم ٥ رك ا ٤ ع ٣ آ ذ ث دػت ٤ بفن ب ٢ اػبع ثش MDA- ػر رب ٢ ثرش ػ ٣ ػ ٥ ت آثبس وش ػ ٥ ٣ سػذ ت سطکريسیهدررد سل لیMDA-MB-468 آپ پت ز تىششبک اوديپالسمیيات فاژی القای آ ؿىؼرن 9 وبػرزبص ورشد فقرب عش ٤ رك اص سا MB-468 فب ر ورشد فقرب چر دػن ٣ ثب س ٥ ب ب ٢ ٣ و ذ. اف ب ا احن ب سش تئ ٥ ( mrna ػغح د )دس XBP1s س ٤ ؼ ٣ دس داسد. مرؾ UPR ث اثؼن ؼ ٥ ش ٤ ه دس آس سن ص ا مب ٢ دس ث ٥ رب افضا ٤ ؾ ثب شا LC3-II/LC3-I ؼجت افضا ٤ ؾ حب ف ٥ ؼر ٥ ش ؿذ فقب ث ٥ ب ش ا احن ب ػبفت( 12 ص ب )تب 9 وبػزبص دس آس سنر ص ثب ؼ ٥ ش د ا ٤ دل ٥ ك استجبط اثجبت اػت. ات فبط ٢ ثب ٤ رذ شتجظو ذ ف ا ػب ٤ ش ثشسػ ٣ عش ٤ ك اص ثقذ ٢ غب قبت ؿ د. ثشسػ ٣ تطكر قذرداوی ي سؿرن تخللر ٣ دونرش ٢ سػرب اص ثخ ٣ حبضش غب ق ذسع تشث ٥ ت دا ب ب ٣ سن ٥ جب ٣ ثب و اػت ثب ٣ ٥ ث ٥ ؿ ٣ ٥ تحم ٥ مبت شوض ل ة ؿ بس تحم ٥ مبت ٣ عشح ا جب ت شا سضؿى ٣ ف دا ب خ ٣ ٥ ا ب ث ٥ بسػنب ػشعب اص سا خر د لرذسدسا ٣ ترىش شاتت ٤ ؼ ذ ب اػت. ؿذ ٣ داس ذ. افال ذسع تشث ٥ ت دا ب سظ ٣ قب ت مىببع [1] Appenzeller-Herzog C, Hall MN. Bidirectional crosstalk between endoplasmic reticulum stress and mtor signaling. Trends Cell Biol 2012; 22(5): [2] Bathaie SZ, Mousavi SZ. New applications and mechanisms of action of saffron and its important ingredients. Crit Rev Food Sci Nutr 2010; 50(8): [3] Abdullaev F. Crocus sativus against cancer. Arch Med Res 2003; 34(4): 354. [4] Karpozilos A, Pavlidis N. The treatment of cancer in Greek antiquity. Eur J Cancer 2004; 40(14): [5] Schmidt M, Betti G, Hensel A. Saffron in phytotherapy: pharmacology and clinical uses. Wien Med Wochenschr 2007; 157(13-14): [6] Carey LA, Perou CM, Livasy CA, Dressler LG, Cowan D, Conway K, Karaca G, Troester MA, Tse CK, Edmiston S, Deming SL, Geradts J, Cheang MC, Nielsen TO, Moorman PG, Earp HS, Millikan RC. Race, breast cancer subtypes, and survival in the Carolina Breast Cancer Study. JAMA 2006; 295(21): [7] Mousavi SM, Montazeri A, Mohagheghi MA, Jarrahi AM, Harirchi I, Najafi M, Ebrahimi M. Breast cancer in Iran: an epidemiological review. Breast J 2007; 13(4): [8] Movahedi M1, Haghighat S, Khayamzadeh M, Moradi A, Ghanbari-Motlagh A, Mirzaei H, Esmail-Akbari M. Survival rate of breast cancer based on geographical variation in iran, a national study. Iran Red Crescent Med J 2012; 14(12): [9] Ron D, Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 2007; 8(7): [10] Samali A, Fitzgerald U, Deegan S, Gupta S. Methods for monitoring endoplasmic reticulum stress and the unfolded protein response. Int J Cell Biol 2010; 2010: [11] Mehrpour M, Esclatine A, Beau I, Codogno P. Overview of macroautophagy regulation in mammalian cells. Cell Res 2010; 20(7): Pathobiology Research, Vol. 20 ( ), N
14 [12] Codogno P, Mehrpour M, Proikas-Cezanne T. Canonical and non-canonical autophagy: variations on a common theme of self-eating? Nat Rev Mol Cell Biol 2011; 13(1): [13] Ogata M, Hino S, Saito A, Morikawa K, Kondo S, Kanemoto S, Murakami T, Taniguchi M, Tanii I, Yoshinaga K, Shiosaka S, Hammarback JA, Urano F, Imaizumi K. Autophagy is activated for cell survival after endoplasmic reticulum stress. Mol Cell Biol 2006; 26(24): [14] Bathaie SZ, Bolhassani A, Tamanoi F. Anticancer Effect and Molecular Targets of Saffron Carotenoids. Enzymes 2014; 36: [15] Ashrafi M, Bathaie SZ, Abroun S, Azizian M. Effect of Crocin on Cell Cycle Regulators in N- Nitroso-N-Methylurea-Induced Breast Cancer in Rats. DNA Cell Biol 2015; 34(11): [16] Sun Y, Yang J, Wang LZ, Sun LR, Dong Q. Crocin attenuates cisplatin-induced liver injury in the mice. Hum Exp Toxicol 2014; 33(8): [17] Festuccia C, Mancini A, Gravina GL, Scarsella L, Llorens S, Alonso GL, Tatone C, Di Cesare E, Jannini EA, Lenzi A, D'Alessandro AM, Carmona M. Antitumor effects of saffronderived carotenoids in prostate cancer cell models. Biomed Res Int 2014; 2014: [18] Noureini SK, Wink M. Antiproliferative effects of crocin in HepG2 cells by telomerase inhibition and htert down-regulation. Asian Pac J Cancer Prev 2012; 13(5): [19] Bolhasani A, Bathaie SZ, Yavari I, Moosavi- Movahedi AA, Ghaffari M. Separation and Purification of Some Components of Iranian ي مکاران حمیدحیدرزاد Saffron. Asian J Chem 2005; 17(2): [20] D'Alessandro AM, Mancini A, Lizzi AR, De Simone A, Marroccella CE, Gravina GL, Tatone C, Festuccia C. Crocus sativus stigma extract and its major constituent crocin possess significant antiproliferative properties against human prostate cancer. Nutr Cancer 2013; 65(6): [21] Hoshyar R, Bathaie SZ, Sadeghizadeh M. Crocin triggers the apoptosis through increasing the Bax/Bcl-2 ratio and caspase activation in human gastric adenocarcinoma, AGS, cells. DNA Cell Biol 2013; 32(2): [22] Luo T, Qin J, Liu M, Luo J, Ding F, Wang M, Zheng L. Astragalus polysaccharide attenuates lipopolysaccharide-induced inflammatory responses in microglial cells: regulation of protein kinase B and nuclear factor-κb signaling. Inflamm Res 2015; 64(3-4): [23] Bakshi HA, Hakkim FL, Sam S. Molecular Mechanism of Crocin Induced Caspase Mediated MCF-7 Cell Death: In Vivo Toxicity Profiling and Ex Vivo Macrophage Activation. Asian Pac J Cancer Prev 2016; 17(3): [24] Bajbouj K, Schulze-Luehrmann J, Diermeier S, Amin A, Schneider-Stock R. The anticancer effect of saffron in two p53 isogenic colorectal cancer cell lines. BMC Complementary and Alternative Medicine 2012; 12: 69. [25] Hetz C. The unfolded protein response: controlling cell fate decisions under ER stress and beyond. Nat Rev Mol Cell Biol 2012; 13(2): [26] Penas C, Font-Nieves M, Forés J, Petegnief V, Planas A, Navarro X, Casas C. Autophagy, and 50 آسیبشىاسیزیستی دير 02 شمار 4 زمستان 9316 پژي ش ای 44
15 ت سطکريسیهدررد سل لیMDA-MB-468 آپ پت ز تىششبک اوديپالسمیيات فاژی القای BiP level decrease are early key events in [27] Cawley K, Deegan S, Samali A, Gupta S. retrograde degeneration of motoneurons. Cell Assays for detecting the unfolded protein Death Differ 2011; 18(10): response. Methods Enzymol 2011; 490: Pathobiology Research, Vol. 20 ( ), N
نااطمینانی تورمی و رشد اقتصادی در ایران
نااطمینانی تورمی و رشد اقتصادی در ایران * دوتش غال شهب ػجبػ ٣ 1 ** دوتش اؿىب سض ٥ صاد *** دا د ػ ب ٣ 3 زى ٥ ذ ت س ٤ ب ث ػجبست ٣ افضا ٤ ؾ ػ ص ػ ٣ ل ٥ ت ب اص خ تغ ٥ ش ب تبث ٥ ش زاس دس التلبد ش و س اػت و
More informationIELTS Writing. HIRAD Specialized Language Center
LESSON ONE ADJECTIVE CLAUSE ؿج خ كفي )ه بيش ك ي( ؿج خ كفي يه اػ سا ت كيف يو ذ. ث بی صيش ت خ و يذ: پؼشی پؼشی و و پيشا ىي پ ؿيذ د ػت ك ي ي اػت. يخ ا ي ثب ا اصد اج و ي خي ي دة اػت. The boy who is wearing
More informationEvaluation of Poly(amidoamine) Dendrimer Surface Modification with Poly(ethylene glycol) on Cytotoxicity Reduction
Original Article Evaluation of Poly(amidoamine) Dendrimer Surface Modification with Poly(ethylene glycol) on Cytotoxicity Reduction Farnoush Jafari Iri Sofla 1, Fatemeh Rahbarizadeh 2*, Davoud Ahmadvand
More informationة ة ف ف ي ف ل ف ن ا م ا
س د رة ت ا ر س ٱ ت خ ل ا ا ة ر ه ب ا ب ث ا ع ل أ ب ع ر و ة ا ل ه ة ة ا ل ب ل ل س ال ا ص ر ل ا ة ح ت غ ل و ك ا ر ب ر و ش ا ر ء ل ل ة ل ا ل ك ة ا خ س س ل ا ل ب ط ت ل ة ا و ل ا د ة و ك ل ة ة ل ز ا إ ل ة ع
More informationعوتال خزاسب ی هجید عببسپ ر 1. عض یئت علوی دا شگب هحیطسیست
ش ١٤ ح ٥ ط ص ٤ ؼت طج ٥ ؼ ٣ بثغ طج ٥ ؼ ٣ ا ٤ شا د س ٠ 67 ؿ بس ٠ 2 تبثؼتب 1393 كفحبت 195-206 ضز رت ب الشاهبت ببس گزی را بزد بی حفبظت اس ت ع سیس یت ایزاى چکید *1 اصغز هحودی فبضل 2 عوتال خزاسب ی 3 هجید عببسپ
More informationKeywords: microrna, RQ-PCR, Endogenous control genes, Dendrosomal curcumin, Hepatocellular carcinoma
Original Article Comparison of snrna-u6 and microrna-16 for Identification of Suitable Endogenous Control Gene for microrna Gene Expression Analysis under Dendrosomal Curcumin Treatment in Hepatocellular
More informationثزرسی تبثیز هذیزیت سزهبی در گزدش ثز عولکزد هبلی ضزکت بی پذیزفت ضذ در ث رس ا راق ث بدار ت زاى
ثزرسی تبثیز هذیزیت سزهبی در گزدش ثز عولکزد هبلی ضزکت بی پذیزفت ضذ در ث رس ا راق ث بدار ت زاى ه زداد کبکبعلی ص هع سزایی* دکتزهحسي هحوذ رثخص ل گز دی ** دکتز ضبعز ثیبثب ی ** کبرض بس ارضذ هذیزیت ثبسرگب ی گزایص
More informationأ ا ل ا ا ا أو و ا ا د أ ا ل ا ة ا رة إ ا ص ذوي ا أو ا ت ا ا ص ذوي ا ا ا وق ا ارد ا أ ب ا ر ا ا ا 1 2 3 4 5 ا أس إ ا م رة ا ا إ ا م و ر»ا «ا ت زاو ا راع ا إ ا راء إ ا ا و ا ا ة ا م ا ا ا ا را م ا ا وأن
More informationCURRICULUM VITAE ALI SABETIPOOR
Name: Ali Sabetipoor Username: asabeti URL: http://asabeti.kashanu.ac.ir Email: a.sabeti@kashanu.ac.ir Tel.: +98 31 5591 2733 Fax: +98 31 5551 3015 Address: Faculty of Literature and Foreign Languages,
More informationFasting. Fr. Andrew Khalil
Fasting Fr. Andrew Khalil Fasting Oldest Commandment Prophets, Priests, Churches fasted. Old and New The Ninevites fasted Fasting John the Baptist and his disciples fasted The Lord fasted Our Holy Fathers
More informationABSTRACT The Title: The contribution of the Endowment in supporting the Scientific an Educational Foundations in Makkah Al-Mukarram during Othmani
ج ABSTRACT The Title: The contribution of the Endowment in supporting the Scientific an Educational Foundations in Makkah Al-Mukarram during Othmani Era and the suggested Techniques to Develop its Role
More informationSarf: 16 th March 2014
Sarf: 16 th March 2014 Sarf = How verbs change ي ا ل ف ع ل ال م اض = verb Past tense ا ل ف ع ل ال م ض ا = verb Present tense ا ل ف ع ل ال م اض ي = verb Past tense You 1m You 2m You 3+m You 1f ف ع ل ف ع
More informationALI 258: Qualities of a Faithful believer Khutba No. 87 March 25, 2014/ Jumadi I 23, 1435
ALI 258: Qualities of a Faithful believer Khutba No. 87 March 25, 2014/ Jumadi I 23, 1435 What is the difference between faith and conviction? What are good qualities of speech and silence? How would you
More informationMuharram 23, 1439 H Ikha 14, 1396 HS October 14, 2017 CE
Muharram 23, 1439 H Ikha 14, 1396 HS October 14, 2017 CE Qalqalah ) ق ل ق لة ( is a method of reading a letter by vibrating it because it has sukoon. There are five qalqalah letters: د ج ب ط ق Two categories
More informationQUR ANIC ARABIC - LEVEL 1. Unit ٢٦ - Present Passive
QUR ANIC ARABIC - LEVEL 1 Unit ٢٦ - Present Passive 1 Today s lesson Present Passive Classwork Unit 26 Correction Unit 21, 22, 23, 24 2 ا ل ف ع ل - Verb Present tense action is incomplete a) either being
More informationSESSION 31 FREQUENT RECITATIONS. I. SPOKEN ARABIC: Use 3SP. For continuity, see Spoken Arabic in previous lesson.
SESSION 31 FREQUENT RECITATIONS I. SPOKEN ARABIC: Use 3SP. For continuity, see Spoken Arabic in previous lesson. () cold. water I want II. GRAMMAR (Verb DF-3): Practice the 21 forms of ج اه د 31 (he struggled;
More informationالگ بی طراحی ز را فبد ست غسال حبئری
الگ بی طراحی ز را فبد ست غسال حبئری تؼریف الگ تبریخچ اجسای الگ لبلت هست ذ سبزی هسایب هؼبیت دست ث ذی تؼریف الگ تؼریف الگ تبریخچ اجسای الگ لبلت هست ذ سبزی هسایب هؼبیت دست ث ذی را حل تىرار ضذ ثرای یه هطىل
More informationAdab 1: Prohibitions of the Tongue. Lecture 3
Adab 1: Prohibitions of the Tongue Lecture 3 The Dunya and some of the Desires The دنيا as a temporary place: It is designed to be a place of distraction. We get distracted because our نفس contains desires
More informationIn the Name of Allah, the Most Gracious, the Most Merciful.
The Virtues of Surat At-Tariq Revealed in Makkah An-Nasa'i recorded that Jabir said, "Mu`adh lead the Maghrib prayer and he recited Al-Baqarah and An-Nisa'. So the Prophet said, أ ف تان أ ن ت ي ا م ع اذ
More informationNone is killed unjustly, but the first son of Adam will have a part of its burden because he was the first to establish the tradition of murdering
ه ث ري ي ل ه ري ولع ق س ان وك ني خو اإل ن ال ا ل د ل ل رب اه ا ل له وح د ه ه ري ي وح ص ى د ق ف ه ظو وغ ن ال إ هل ه ال د وأش أ إ خ و ه د ا ها ب ي ا ه ن س ي د و م د أ ت ني وأ يك هل ال و ك ا ل ق ال ال ش ه
More informationچطنانذازهذيريتدولتي هذلرياضيبودجهريسيدربخصعووهي:رويكردبهينهسازياستوار
ی ب چطنانذازهذيريتدولتي 1390 ص ستب 8 ض بس 83-98 ظظ هذلرياضيبودجهريسيدربخصعووهي:رويكردبهينهسازياستوار 1** * سجادنجفي عادلآرر چكيذه سؾبیت ث زا است و س ش بی ثش جت ی تدشثی ر ی غب جب بثى تخػیع ا ش ص و ی هشی
More informationن ن ار ن ل ا ة ل ا س ر ة رع م ا ءا ل ع ل ا ة أ ن ل
ا س ا ل ة ا غ ل أ ا لعل ا ء ال ا ع ل ب ة عح ت د ا ا ل د ل و ش و و ش ا ء ل ل ة ل ا ل ك ة ا خ س ل ا ل ب ط ت ة ا و ل ا ع د ة و ك ا ل ة ة ل ة ا إ ل ت ع ا ل ع ا ل ك ة ت ب ا ا ل ح ب ص ال ا ت س ع ل ة ا و حل و
More informationحرکت فلکشه مفصل آروج با ورمافزار ADAMS
و 4 پض ص در ت ا بخطی رسضی د ر ضوار ب ار تابستاى 93...WW.WWAR.RWR.WWW نشریه پژوهش در توانبخشی ورزشی دوره شماره بهار و تابستان 93 - محاسبهی مىحىی گشتاير ایزيکیىتیک ي مقایسهی حرکت فلکشه مفصل آروج با ورمافزار
More information1 st 10 Nights and Days of Dhu l-hijjah
1 st 10 Nights and Days of Dhu l-hijjah Salaah for 1 st 10 Nights Dua after Fajr and Maghrib Prayers for the 1 st 9 Nights Dua for the 1 st 10 Days Tasbih to be Recited on the 1 st 10 Days Amaal for the
More informationWelcome to ALI 440: Topical Tafsir of Quran Family Relationships
Welcome to ALI 440: Topical Tafsir of Quran Family Relationships Check the following verses in your copy of the Quran Verses for today s session 1) Sura Nur, no.24, verse 36 2) Sura Nahl, no.16, verse
More informationCommon Supplications (Du aas) recited during the Day
, Most Beneficent, Most Merciful Common Supplications (Du aas) recited during the Day www.understandquran.com ***** After getting up ***** ال حم د ال ذ ي ح يانا gave us life Who to Allah بع د ما ماتنا
More informationRevealed in Mecca. Consist of 34 verses LESSONS FROM LUQMAN. Br. Wael Ibrahim. How can we implement the lessons in our daily lives?
Revealed in Mecca Consist of 34 verses LESSONS FROM LUQMAN Br. Wael Ibrahim How can we implement the lessons in our daily lives? The Chapter of Child Education The chapter is about Luqman s education and
More informationMadrasa Tajweedul Quran
Ijra - Explaining Tajweed Rules Notes for Teachers: Ijra of Tajweed rules is essential for pupils to fully understand the rules. Where pupils explain Tajweed rules in their own words, this creates a deeper
More informationDua Mujeer 13, 14, 15. th th th.
Dua Mujeer th th th 13, 14, 15 www.qfatima.com DUA AL MUJEER Recommended to recite in the Ayyamul Baydh (13, 14, 15 th nights) of the month of Ramadhan. The Prophet (pbuh) was praying at Maqami Ibraheem
More informationThe First Ten or Last Ten Verses of Sūrah al-kahf
K N O W I N G F A L S E M E S S I A H Protection from the Dajjāl s Tribulations Despite the great tribulations the Dajjāl brings by which Allah will test his servants, we are not left to face them alone.
More information(When he said to his father and his people: "What do you worship'') meaning: what are these statues to which you are so devoted
ASH-SHU'ARA (69-110) How the Close Friend of Allah, Ibrahim spoke out against Shirk و ات ل ع ل ي ه م ن ب ا إ ب ر ه يم - إ ذ ق ال لا ب يه و ق و م ه م ا ت ع ب د ون - ق ال وا ن ع ب د أ ص ن اما ف ن ظ ل ل ه
More informationGoing for the ziyārah of the Ahl al-bayt (A)
CLASS 8 Going for the ziyārah of the Ahl al-bayt (A) Learning Objectives Why do we go for the ziyārah of the Ahl al-bayt (A)? What do we do when on ziyārah? Memorise verses 4:100 & 3:169 Going for ziyārah
More informationAllah accepts only from the pious. (5:27)
ه ح ي ا ع ف ق ح د أ ن ل ع ف ح ضل ال شام ل ه و إ ح حساى ال ح ك م ل ل ع ه و ح حد ه ال ش يك ح ن ال إ هل إ ه ال ا ل ل د ح شه أ ال ح هد ل ل ان و ص ي ان و أ ض ق ي ام ر م و أ ح شه د أ ه ن س ي د ى ا و ى ب ه يي
More informationOur bodies & health is a trust & gift from Allah, therefore we must use it responsibly, not waste it, and maximise its benefit. Muslims/Asians are
اى ح ذ ى ي اى ذ ت ع ا ب ع ت اى ع اف ت و ؤ ش ه ذ ؤ ى ا إ ى إ ى ا اىي و ح ذ ى ا ش ز ل ى و ؤ ش ه ذ ؤ ط ذ ا و ب ا ح ذ ا ع ب ذ اىي و ر ط ىى ؤ ر ط ي ر ب ب خ ز اىذ ا و اى أخ ز ة ص ي اىي و ط ي و ب ار ك ع ي و ع
More informationدیدگاه دانشجویان بهداشت عمومی دانشگاه علوم پزشکی کردستان در مورد رشته تحصیلی و آینده شغلی و عوامل مرتبط با آن سال 1393
دیدگاه دانشجویان بهداشت عمومی دانشگاه علوم پزشکی کردستان در مورد رشته تحصیلی و آینده شغلی و عوامل مرتبط با آن سال 1393 * احمد وهابی بشری وهابی اسماء خاطری مریم میرزایی مهیه احمدیان چکیده مقدمه و هدف :
More informationContents. Transliteration Key إ أ) ء (a slight catch in the breath) غ gh (similar to French r)
Transliteration Key إ أ) ء (a slight catch in the breath) غ gh (similar to French r) (ئ f ف a ا throat) q (heavy k, from the ق b ب t ة) has an h sound at the end of k ك ة, ت a sentence) l ل thorn ) th
More informationتزرسی اثز فشای د عاهل سا پذیزی تز قدرت ت ضیحد دگی هدل س عاهلی فاها فز چ در ت رط ا راق ت ادار ت زاى
راهبرد مديريت مالي سال اول شماره 3 زمستان 1392 صص 89110 دانشگاه الشهزا )س( دانشكده علوم اجتماعي و اقتصادي تاريخ دريافت: 92/8/11 تاريخ تصويب: 92/9/23 تزرسی اثز فشای د عاهل سا پذیزی تز قدرت ت ضیحد دگی هدل
More informationث غ ٱ ٱ ش ؽ ٱ ش ؽ ٤ ا ؾ ذ ٱ ز ١ ٤ ظ و ن بئ د اك غ ال ؼ ي بئ ب غ
Dua of Imam Husain (as) for the Day of Arafah The supplicatory prayer of Imam al-husayn (`a), the Chief of Martyrs, on the `Arafat Day is one of the famous prayers. Bishr and Bashir, the sons of Ghalib
More informationIMAM SAJJAD INSTITUTE
IMAM SAJJAD INSTITUTE ع) Have we ever thought about the conditions of true tawbah? Many of us may conjecture that perhaps the factors of regret and expression of sorrow to God can suffice for tawbah. The
More informationStory #4 Surah Al-Qasas [Verses 76- ]
Story #4 Surah Al-Qasas [Verses 76- ] You need to feel the importance of each story in the Quran! Never think that the situation is not for you or doesn t apply to you! Every story mentioned in the Quran
More informationدا طد ی وبسض بسی اسضذ سضت ذیشیت ثبصس ب ی دا ط ب ػ تحمیمبت احذ بص ذسا
چکیده : ای یب عوامل موثر بر ارزش ویژه برند مبتنی بر مشتری دکتر جمطیذ ساالر استبدیبس دا ط ب پیب س حسیه علیخان گرگاوی ي یل دا طد ی وبسض بسی اسضذ ثبصاسیبثی دا ط ب آصاد اسال ی سضت اهلل جعفری الکامی Valiolah.jafari@yahoo.com
More informationSunnah of the Month Eid Al - Adha & Hajj Hadith of the Month. The reward of Hajj Mabrur (accepted) is nothing but Al- Jannah.
August School Re-opens Fun Day Independence Day Eid ul Adha Holidays 1 st 11 th 14 th 9 th 12 th Zilhaaj Eid Al - Adha & Hajj ال ح ج ال م ب ر ور ل ي س ل ه ج ز اء إال ال ج ن ة The reward of Hajj Mabrur
More informationاط ا چگ هؼ ه د ذ ت هؼشف س ىشد خذ ذ دس تاب مؾ اط ا د گش احذ ا صتا دس
سال سوم- شماره 6- پاییز و زمستان 9 معرفی و نقد اى ا ا ض واژهها چگونه معنی میدهند: مفاهیم واژگانی الگوهای شناختی و ساختار معنی آوؼف سد: ا تاسات دا گا آوؼف سد )009(. ساحل گ ذهىاس اط ا چگ هؼ ه د ذ ت هؼشف
More informationSirah of Sayyida Fatima al-zahraa d
Sirah of Sayyida Fatima al-zahraa d ALI 233 Session 3: Tuesday, JCC, Toronto 19 Jamadi II 1434/ 30 April 2013 1 Sûrah al-nahl, Ayat 58 & 59 ب سم الل ه الر مح ن الر حيم * و إ ذا ب ش ر أ ح د ه م ب األ نثى
More informationISTIGHFAAR Combined with The 99 Names of Allah
ISTIGHFAAR Combined with The 99 Names of Allah kwdwdsadsadsdsdfsfdswthis is a simple short Istighfaar formula to attain closeness to Allah and forgiveness of sins. The benefit of this formula is that a
More informationALI 241: Akhlāq of the Ahlul Bayt c
ALI 241: Akhlāq of the Ahlul Bayt c Session 4: JCC; Tuesday 17 Dhul Qa dah 1434/ September 24, 2013 1 From the course outline In the name of Allah, the Beneficent, the Merciful. Session 4: Session 4: Tawādu
More informationALI 340: Elements of Effective Communication Session Six
Communication Session Six Imam Zaynul Abidin (a) when asked about speaking or silence, which was better, he said: For each of these two there are harms and when they are both safe from harm speaking is
More informationALI 256: Spiritual and Jurisprudential aspects Salaat
ALI 256: Spiritual and aspects Salaat SESSION 3: Al-Sadiq Seminary Surrey, BC March 1, 2014/ Rabi II 29, 1435 1 Getting closer thru Du ā, 2:186 و إ ذ ا س أ ل ك ع ب اد ي ع ي ن ف إ ي ن ق ر يب أ ج يب د ع
More informationALI 340: Elements of Effective Communication Session Four
Communication Session Four و و و أ م ا ح ق الل س ان ف إك ر ام ه ع ن ا ل ن وت ع و يد ه ا ل ي ت رك ال ف ض ول ال يت ال فائ د ة ل ا و ال ب بالن ا س ح س ن الق ول فيهم The right of the tongue is that you consider
More informationQuran Spelling Bee Second Level (Third to fifth grade) competition words
Meaning Mercy Word From Quran 1. ر ح م ة And when و ل م ا. 2 That we are أ ن ا 3. Spelling Ra H a Meem Ta marbootah Fathatan, Waw Lam Meem Shaddah Alif Hamzah-on-Alif Noon Shaddah Alif The prophet Nooh(P.B.U.H)
More informationAyatul Kursi (2: )
Ayatul Kursi (2:255-257) Ayatul Kursi (2:255-257) & Aamenar Rasul (2:285, 286) My Ayatul Kursi & Aamenar Rasul Workbook www.qfatima.com Name: AYATUL KURSI Suratul Baqara 2:255 257 The verse of the 'Throne'
More informationبسم الله الرحمن الرحيم
1 بسم الله الرحمن الرحيم Eradicating Hunger from Society إ اى ح ذ ى ي ح ذ و غ ح ؼ و غ ح غ ف ش و غ ح ه ذ و ح ى ة إى و ؼ ىر ث بىي ش ش وس أ ف غ ب و ع ئ بت أ ػ بى ب ه ذ اىي ف ي ب ض و ى و ض ي ي ف ي ب بد ى و
More informationImamate and Wilayah, Part 7
Published on Books on Islam and Muslims Al-Islam.org (https://www.al-islam.org) Home > Imamate and Wilayah, Part 7 Imamate and Wilayah, Part 7 Authors(s): Mohammad Ali Shomali [3] Publisher(s): Ahlul Bayt
More informationAlHaaqqa. In the name of Allah, Most Gracious, Most Merciful Sahih Intl S. Maududi Yousuf Ali M. Pickthall Al-Quran 1. The Inevitable Reality.
AlHaaqqa In the name of Allah, Most Gracious, Most Merciful 1. The Inevitable Reality. Inevitable Reality? 3. And what can make you know what is the Inevitable Reality? 4. Thamud and Aad denied the striking
More informationITA AT: TO OBEY HIM WITHOUT QUESTION
ITA AT: TO OBEY HIM WITHOUT QUESTION جل جلالهAllah sent the Anbiya to be obeyed. This makes logical sense because this is the first principle of change, that the change must be implemented for people to
More informationپژ ص ای هذیزیت عو هی سال ن ضوار سی چ ارم سهستاى 1335 تاریخ دریافت: 35/3/6 تاریخ پذیزش: 35/8/3
پژ ص ای هذیزیت عو هی سال ن ضوار سی چ ارم سهستاى 1335 صفح 115-134 تاریخ دریافت: 35/3/6 تاریخ پذیزش: 35/8/3 Investigating the Relationship between Quality of work life(qwl) and Professional Ethical Culture
More informationThe Reason for the Revelation of this Surah and its Virtues
Revealed in Makkah The Reason for the Revelation of this Surah and its Virtues Imam Ahmad recorded from Ubayy bin Ka`b that the idolators said to the Prophet, "O Muhammad! Tell us the lineage of your Lord.''
More informationا ح د أ ز ح ا س اح ني ح ث ع ا ت س اح ث ا بس أ ج ع ني, أ ال إ إ ال ا و ح د ال ش س ه ا ه ا ح ك ا ج ني و أ ش ه د أ س د ب
ا ح د أ ز ح ا س اح ني ح ث ع ا ت س اح ث ا بس أ ج ع ني, و أ ش ه د أ ال إ إ ال ا و ح د ال ش س ه ا ه ا ح ك ا ج ني و أ ش ه د أ س د ب و ج ب ح د ا ع ج د ا و ز س ى, أ ا بس ل ج ب و أ و ث س ث س ا و ع ط ف ب ف ب ه
More informationTHE RIGHTS OF RASOOLULLAH ON HIS UMMAH ARE 7:
THE RIGHTS OF RASOOLULLAH ON HIS UMMAH ARE 7: 1. Adab wa Ihtiraam: Our attitude of the utmost respect and honor; 2. Ita at: To obey him without question 3. Ittiba: To follow and emulate him in every way
More informationFriday Sermon September 10 th 2010
A comprehensive discourse on various Qur anic prayers at the last day of Ramadan Friday Sermon September 10 th 2010 NOTE: Al Islam Team takes full responsibility for any errors or miscommunication in this
More informationTable 1: Level of evidence (LE) Type of evidence. Table 2: Grade of recommendation (GR) Nature of recommendations
Table 1: Level of evidence (LE) Level Type of evidence 1a Evidence obtained from meta-analysis of randomized trials 1b Evidence obtained from at least one randomized trial 2a Evidence obtained from one
More informationتوانايی استدالل اخالقی دانشجويان پرستاری دانشگاه علوم پزشکی شهید صدوقی يزد
دوره ایران 27 شماره -19 19 آبان و دی ماه -991 9313 992 چکیده توانايی استدالل اخالقی دانشجويان پرستاری دانشگاه علوم پزشکی شهید صدوقی يزد 1 فریبب بر بوی 2 *سید ال بم فضل ج 3 عببس عببس زاد زمینه و هدف: ح
More informationThe Virtues of Surah Al-Infitar
Revealed in Makkah The Virtues of Surah Al-Infitar An-Nasa'i recorded from Jabir that Mu`adh stood and lead the people in the Night prayer, and he made the recitation of his prayer long. So the Prophet
More informationآفح انكغم و انرغى ف. Procrastination, Laziness & Sedentary
ان ح ذ ن ه ان ز ي خ ه ق ا ي ط ني ث ى ق ض ى أ ج ال و خ ه ق ان ى خ و ان ح اج ن ث ه ى ا أ ا أ ح غ ع ال أ ح ذ ع ث ح ا ك ا ح ة و ش ض ى و أ ش ه ذ أ ال إ ن إ ال انه و ح ذ ال ش ش ك ن أ ق غ ى ت انه م و ان ه اس
More informationChapter 26: The Sin of Favoritism Be Just With Your Children
!1 : The Sin of Favoritism Be Just With Your Children بسم اهلل الرحمن الرحيم It was narrated that An-Nu'man said: "My mother asked my father for a gift and he gave it to me. She said: 'I will not be contented
More informationBeing Grateful. From the Resident Aalima at Hujjat KSIMC London, Dr Masuma Jaffer address:
Being Grateful. From the Resident Aalima at Hujjat KSIMC London, Dr Masuma Jaffer Email address: aalima@hujjat.org Objective.. ل ئ ن ش ك ر ت م ل ز يد ن ك م.. Surah Ibrahim: If you are grateful, I would
More informationIf you need Urdu and Arabic fonts to have these pages as they appear on the website, please contact us at:
If you need Urdu and Arabic fonts to have these pages as they appear on the website, please contact us at: quranictopics@yahoo.com www.quranictopics.com We will muster together all human beings in a way
More informationIn the Messenger of Allah, we have an Excellent Example
In the Messenger of Allah, we have an Excellent Example 21/01/2012 www.detailedquran.com Some Muslims site the following Ayah (along with 53:3-4 dealt with in another document) to advocate giving books
More informationThe criteria of healthy humans from the perspective of religious texts
Journal of Research on Religion & Health.2018;4(1): 104-117 Journal Homepage: http://journals.sbmu.ac.ir/jrrh The criteria of healthy humans from the perspective of religious texts Mahdi Fani 1, Morteza
More informationIn the Name of Allah, the All-Beneficent, the All-Merciful IMPORANT INFORMATION ABOUT STRENGHTENING THE INTELLECT:
1 In the Name of Allah, the All-Beneficent, the All-Merciful FOODS THAT HAVE POSITIVE EFFECT ON THE BRAIN IMPORANT INFORMATION ABOUT STRENGHTENING THE INTELLECT: 1. CONSUMING VINEGAR: Ahmad bin Muhammad
More informationKnowing Allah (SWT) Through Nahjul Balagha. Khutba 91: Examining the Attributes of Allah
Knowing Allah (SWT) Through Nahjul Balagha Khutba 91: Examining the Attributes of Allah Reminder when Participating in the Chat 1) Do not write any personal information in the chat box (involving your
More informationRabi`ul Awwal 13, 1439 H Fatah 2, 1396 HS December 2, 2017 CE
Rabi`ul Awwal 13, 1439 H Fatah 2, 1396 HS December 2, 2017 CE ح ر ك ات ( There are three basic vowels ( and they have to be read in short single ح ر ك ة stroke ١ stroke: upper ف ت ح ة 1. stroke: front
More informationAdab 1: Prohibitions of the Tongue. Lecture 6
Adab 1: Prohibitions of the Tongue Lecture 6 1 Prohibitions In previous lectures we have established the grounds for why this book is important. Dangers of the tongue Rewards and benefits of the silent
More informationSurah Mumtahina. Tafseer Part 1
Surah Mumtahina Tafseer Part 1 In the name of Allah the Gracious and Most Merciful 1. O you who have believed, do not take My enemies and your enemies as allies, extending to them affection while they
More informationRace to Jannah - 6 Group E: Surah Taha
طھ{ 1 } Race to Jannah - 6 Group E: Surah Taha ب س م ال رح م ن ال رح یم In the name of Allah, the Most Gracious, the Most Merciful م ا أ ن ز ل ن ا ع ل ی ك ال ق ر آن ل ت ش ق ى إ لا ت ذ ك ر ة ل م ن ی خ ش
More informationSuggested Global Islamic Calendar By Khalid Shaukat, prepared for
Suggested Global Islamic Calendar By Khalid Shaukat, prepared for The Experts Meeting to Study the Subject of Lunar Months Calculation among Muslims Allah subhanahu wa ta ala says in Qur an: Rabat 9-10
More informationThe Transparent Life
الحياة الشفافة The Transparent Life The good life is for the one who believes in Allah و ت""عال""ى) (س""بحان""ه and does righteous good deeds based on his faith. م ن ع م ل ص ال ح ا من ذ ك ر أ و أ نث ى
More informationماهنامه علمی پژوهشی مهندسی مکانیک مدرس. mme.modares.ac.ir
مجله مهنذسی مکانیک مذرس خرداد 6931 دوره 61 شماره 9 صص 93-63 ماهنامه علمی پژوهشی مهندسی مکانیک مدرس mme.modares.ac.ir بررسی نتایج مذلسازی چنذشعاعی با مذل تکشعاعی در جریان بخار آب چگالشی در نازل همگرا-واگرای
More informationHazrat Ameer s Ramadan Message
) P P س م الله ا ل ر حم ن ا ل ر ح ی م Hazrat Ameer s Ramadan Message 1432 Hijrah, August 2011 م ن كم ق ن ه د ى ل لن اس و بي ن ا ال ه دى و ال ف ر قان فم ن ش ه د ل ف یه ال ر آ ذ ي آ ش ه ر ر م ضان ال ه صلے
More information23 FEBRUARY RABEE AL AKHAR 1435 CLASS #28
أنا من -? I M Y L I F E P R O J E C T W H O AM 23 FEBRUARY 2014 23 RABEE AL AKHAR 1435 CLASS #28 In order to answer this question The Reality of the Human is in the Quran, just as Allah has described us
More informationDu ā 44 For Supplication for the Coming of the Month of Ramadan in the Sahīfa with two Translations
Du ā 44 For Supplication for the Coming of the Month of Ramadan in the Sahīfa with two Translations 1 Translation by Dr. William C. Chittick His Supplication For The Coming Of The Month Of Ramadan 1. Praise
More informationSubmission is the name of an Attitude
Submission is the name of an Attitude Mirza Yawar Baig Children are taught in kindergarten that A is for apple. If they go to Islamic school they are taught that it doesn t stand for apple but for.جل جلالهAllah
More informationISLAMIC CREED ( I ) Instructor: Dr. Mohamed Salah
ISLAMIC CREED ( I ) العقيدة اإلسالمية Instructor: Dr. Mohamed Salah Islamic Creed Series THE IMPORTANCE OF STUDYING AQEEDAH Imam Abu-Hanifa said, "The understanding of faith is better than understanding
More informationQuestions & Answers Answers
Questions & Answers Code: Beliefs Cognition about God s Caliph on earth About Mansoor and his preparation of the grounds for advent of Mahdi 3 Author: Unknown Date: 20/01/2015 In case a ruler from one
More information1. In Islam there is NO hatred of others. WE DO NOT DIFFERENTIATE on Race, Ethnicity, Colour, Nationality or Religion.
اى ح ذ ى ي اى ز ي أ ز ه اى ن ت اب و ى ج ع و ى ع ى ج ا و ج ع و ى ات ق ا ف ش ج ا و خ ش ج ا و أ ش ه ذ أ ال إ ى إ ال اىي و ح ذ ال ش ش ل ى أ ز ه اى ق ش آ ذ ا ة و ىس ا و أ ش ه ذ أ س ذ ا و ب ا ح ذ ا ع ب ذ اىي
More informationبزرسی خواص آنتی اکسیدانی و ضد ببکتزیبیی اسبنس جعفزی بز روی تعدادی اس ببکتزیهبی عبمل فسبد و بیمبریسای غذایی
مجله مکروب شن مواد غذا ئ بزرس خواص آنت اکسدان و ضد ببکتزب بنس جعفز بز رو تعداد ببکتزهب عبمل چکده فسبد و بمبرسا غذا 3 * رضب شزافت چبلشتز محمود رفعبن کوپبئ عل شزافت چبلشتز الهبم صبلح. شوض تحممبت ث ؿ تغز
More informationIn the Name of Allah, the Most Gracious, the Most Merciful.
Revealed in Makkah ب س م ال له ال رح م ن ال رح يم In the Name of Allah, the Most Gracious, the Most Merciful. و ال ع د ي ت ض ب حا 100:1 By the `Adiyat (steeds), snorting. ف الم ور ي ت ق د حا 100:2 Striking
More information23 MARCH JAMAD AL AWWAL 1435 CLASS #32
أنا من -? I M Y L I F E P R O J E C T WHO AM 23 MARCH 2014 22 JAMAD AL AWWAL 1435 CLASS #32 In order to answer this question The Reality of the Human is in the Quran, just as Allah has described us REALITY
More informationSalah The Backbone of Islam
الحمد هلل الذ ي جعل الصالة للمؤمنين نورا وراحة وسرورا أحمد ه سبحان و حمد ا يليق بجال ل وأنيس وجه و وعظيم سلطان و و أ ش ه د أ ن ال إ ل و إ ال الل و و ح د ه ال ش ر يك ل و و ل ي الصالحين المتقين ولعبادت و
More informationOne-Eyed, Blind in the Other
The Dajjāl s Physical Features One-Eyed, Blind in the Other Imām Muslim collected a ḥadīth from Ḥudhayfah ( رضي اهلل عنه ) who narrated that Allah s messenger ( صل ى اهلل عليه وسل م ) said: ف ن ار ه ج
More informationHE NEEDS TO COMPLETE RECITATION OF THE WHOLE QUR AN IN AN
The carrier of the Qur an cannot have the same behavior as the one who is not a carrier of the Qur an. This is a big responsibility- to be a muslimah who is a carrier of the Qur an and to be a student
More informationUnderstanding God s Mercy, Part 7
Published on Al-Islam.org (https://www.al-islam.org) Home > Understanding God s Mercy, Part 7 Understanding God s Mercy, Part 7 Authors(s): Mohammad Ali Shomali [1] Publisher(s): Ahlul Bayt World Assembly
More informationThis Life A N D A B E L I E V E R S P E R S P E C T I V E I N I T
T H E N A T U R E O F This Life A N D A B E L I E V E R S P E R S P E C T I V E I N I T Selected Ḥadīth of Raqāiq from Silsilah al-aḥādīth al-ṣaḥīḥah Collected by: Muḥammad Nāṣir al-dīn al-albānī 1 1 The
More informationON TRAVELING: A FEW PERSONAL DUʿĀS AND SPIRITUAL PRACTICES 1
In the name of Allah, Most Gracious, Most Merciful And may peace and blessings be upon His servant Muḥammad, and upon his family and Companions ON TRAVELING: A FEW PERSONAL DUʿĀS AND SPIRITUAL PRACTICES
More informationIslam and The Environment
Islam and The Environment By Sh Kazi Luthfur Rahman Human beings are representatives of Allah: Allah, the almighty appointed human beings as his representatives in this world and he made them responsible
More informationIn the Name of Allah, the Most Gracious, the Most Merciful.
Revealed in Makkah ب س م ال له ال رح م ن ال رح يم In the Name of Allah, the Most Gracious, the Most Merciful. إ نا أ نز ل ن ه ف ى ل ي ل ة ال ق د ر 97:1 Verily, We have sent it down in the Night of Al-
More informationK n o w A l l a h i n P r o s p e r i t y
K n o w A l l a h i n P r o s p e r i t y H E W I L L K N O W Y O U I N A D V E R S I T Y Selections 1 from Jāmi al- Ulūm wal-ḥikam by: Ibn Rajab al-ḥanbalī 1 Taken from Ibn Rajab al-ḥanbalī s book Jāmi
More informationHis supplication in Asking for Water during a Drought
ALI 226: Du as 19 and 23 Sahifa February 2013/ Rabi I & II, 1434 و ك ان م ن د ع ائ ه ع ل ي ه الس ل ام ع ن د ال اس ت س ق اء ب ع د ال ج د ب His supplication in Asking for Water during a Drought 1 Quiz on
More informationSo we are here today to facilitate the marriage of two human beings on the basis of love and companionship:
إن الحمد هلل نحمده ونستعينه ونستغفره ونعوذ باهلل من شرور أنفسنا ومن سيئات أعمالنا من يهده هللا فال مضل له ومن يضلل فال هادي له وأشهد أن ال إله إال هللا وحده ال شريك له وأشهد أن محمدا عبده ورسوله. All praise
More informationSunday Evening Series Class #6. Introduction: 1 P a g e. Date: 05 August 2018 / 23 Dhul Qu da 1439
(ذكرى الدار اآلخرة ( Abode Remembrance of the Last Sunday Evening Series Class #6 Date: 05 August 2018 / 23 Dhul Qu da 1439 Introduction: Allah is Ar Razaq and He s the Provider. There is general and special
More information